Module: Bioroebe

Included in:
Defined in:



require ‘bioroebe/fasta/split_this_fasta_file_into_chromosomes/constants.rb’


Defined Under Namespace

Modules: BaseModule, Biomart, Blosum, CodonTable, CodonTables, CodonTablesFrequencies, ColourScheme, Colourize, ColoursForBase, CommandlineArguments, Configuration, ElectronMicroscopy, EmbeddableInterface, Features, GUI, InferTheNamespaceModule, InternalHashModule, MolecularWeightOfNucleotides, NucleotideModule, Parser, Postgresql, Quiz, RestrictionEnzymes, SinatraInterface, Taxonomy, VerboseTruth Classes: AdvancedDotplot, AlignOpenReadingFrames, Alignment, AlphaHelix, AminoacidSubstitution, AminoacidsMassTable, AnalyseGlycosylationPattern, AnalyseLocalDataset, AutocorrectTheNameOfThisFastaFile, B_cell, Base, BiolangParser, BlosumParser, CalculateBlosumScore, CalculateGCContent, CalculateMeltingTemperature, CalculateMeltingTemperatureForMoreThanThirteenNucleotides, CalculateThePositionSpecificScoringMatrix, Cell, CheckForMismatches, CodonPercentage, ColourSchemeDemo, ColourizeHydrophilicAndHydrophobicAminoacids, ColourizeSequence, CommandlineApplication, CompactFastaFile, Compacter, CompareTheseTwoSequencesViaBlosum, ComplementaryDnaStrand, Compseq, ConsensusSequence, ConvertAminoacidToDNA, ConvertThisCodonToThatAminoacid, CountAmountOfAminoacids, CountAmountOfNucleotides, CreateAnnotationFormat, CreateBatchEntrezFile, CreateRandomAminoacids, DNA, DeduceAminoacidSequence, DetectMinimalCodon, DetermineAntigenicAreas, DetermineMissingNucleotidesPercentage, DetermineOptimalCodons, Digestion, DisplayAminoacidTable, DisplayHowManyFastaEntriesAreInThisDirectory, DisplayOpenReadingFrames, DnaToAminoacidSequence, DotAlignment, Dotplot, DownloadFasta, DownloadFilesFromRebase, DownloadTaxonomyDatabase, FastaDefline, FastaParser, FastaToYaml, FastqFormatExplainer, FetchDataFromUniprot, FetchFastaSequenceFromPdb, FindGene, FindLongestSubstring, FindLongestSubstringViaLCSalgorithm, GenbankFlatFileFormatGenerator, GenbankParser, Gene, Genome, GenomePattern, GenomeRetriever, HammingDistance, HelixWheel, InvalidAminoacid, LengthModifier, Levensthein, Macrophage, MatplotlibGenerator, Matrix, MirrorRepeat, MostLikelyNucleotideSequenceForThisAminoacidSequence, MoveFileToItsCorrectLocation, Ncbi, Palindrome2DStructure, PalindromeFinder, PalindromeGenerator, ParseEMBL, ParseFasta, ParseFastq, ParseFrequencyTable, ParsePdbFile, ParseTaxonomy, ParsemmCIFFile, Pathways, Permutations, PhredQualityScoreTable, PossibleCodonsForThisAminoacid, ProfilePattern, Protein, Punnet, RGG_Scanner, RNA, RNALfoldWrapper, RawSequence, ReportSecondaryStructuresFromThisPdbFile, RestrictionEnzyme, ReverseComplement, Ruler, SVG, SanitizeCodonFrequency, SanitizeNucleotideSequence, ScanForRepeat, Sequence, Shell, ShowCodonTables, ShowCodonUsage, ShowFastaHeaders, ShowFastaStatistics, ShowHydrophobicity, ShowNucleotideSequence, ShowOrf, ShowRestrictionEnzymes, ShowThisCodonTable, ShowThisDNASequence, SiRNA, SimpleStringComparer, SimplifyFastaHeader, SinatraWrapper, SmithWaterman, SplitThisFastaFileIntoChromosomes, StrideParser, T_cell, TobaccoMosaicVirus, Trypsin, UsefulFormulas, Virus

Constant Summary collapse



The following constant will denote which colour we will use for DNA sequences by default, in this case, the HTML colour called steelblue.

















This is called pdb_and_protein_structure/ since as of November 2023.



























This constant will point to e. g. “/Programs/Ruby/2.6.4/lib/ruby/site_ruby/2.6.0/bioroebe/yaml/pathways/”.











This variable keeps track as to when the bioroebe project was last updated. The notation is: DD.MM.YYYY



Keep track of where the documentation to BioRoebe is kept at.

Aminoacids =

The following “alias” was added in May 2022.





Seq =

Usage example


N =


R =






This constant is not often in use, though.







Just list the aminoacids that can typically be phosphorylated.

  S Y T


We have to keep the long names for the amino acids in one constant, so that we can do queries lateron.

) << 'Aspartic acid' << 'Glutamic acid').sort


Which Aminoacids are possible/allowed? We will list them here:


Note that this is distinct from the constant AMINO_ACIDS, which is instead loaded from a local .yml file. This constant includes all the 20 canonical aminoacids, whereas AMINO_ACIDS may also include pyrrolysine and selenocysteine.





This keeps an Array with all aminoacids, in one-letter format.

So it is equivalent to:

["A", "C", "D", "E", "F", "G", "H", "I", "K", "L", "M", "N", "P", "Q", "R", "S", "T", "V", "W", "Y"]




  'citratzyklus' => {
    # Alpha-Ketoglutarat: EPQR
    'alpha-ketoglutarat' => %w( E P Q R ),
    # Oxalacetat: DMN-KTI
    'oxalacetat' => %w( D N K M T I ),
  'glykolyse' => {
    'pyruvat' => %w( A V L ),                 # AVL
    '3-phosphoglycerinsäure' => %w( S G C ), # SGC
    'chorismat' => {
      'aromatische_familie' => %w( F Y W )       # FYW
    'ribose-5-p' => {
      'histidinol' => %w( H ) # Histidine.


All ways to exit will be recorded here.

If you need to use more ways, simply append to this Array.

This constant may have to be moved into the bio-shell part eventually.

  quit q exit qq :q qt


This used to belong to the Taxonomy submodule.



This used to belong to the Taxonomy submodule.



This used to belong to the Taxonomy submodule.



This constant exists specifically for the taxonomy-component of the Bioroebe project.



This constant can be used as the default prompt for the bioshell component.



This is a default “test” DNA sequence, in the sense that it can be used to quickly test functionality within the bioroebe project.

It was added in May 2020, but it may be that we have to remove it at a later time, or move it into a separate .yml file. For the time being, though, it will reside here.



How long our DNA-generated strings should be by default.

This may be used by some scripts, so it provides a default value for use in these scripts.

150 nucleotides are the current default.




An alias to the above.







This constant is only useful on my home directory. Most other users will not need it, ever.







This constant can be set to determine where relion resides. It is mostly an ad-hoc constant.



ARRAY_REGISTERED_ACTIONS becomes @registered_actions.





My email address - not too terribly useful for other people, but nonetheless it may be useful to display it, in particular for GUI-related components of the bioroebe-project and simple feedback in the long run.

'[email protected]'


See rubular at:




The STOP codons that can be found in Humans, in RNA format.



This will refer to an Array including all four RNA nucleotides, that is A, U, G and C.

%w( A U G C )




This is a bit different to RNA_NUCLEOTIDES in that N is also a part of it. It is not entirely clear whether this array here is kept, though.

  A U G C N


This is the variant without N.

%w( A T G C )


Since as of 20.04.2014, Uracil is also part of this Hash. While this is, strictly speaking, not absolutely correct, it does simplify some downstream code. However had, this may possibly be re-evaluated in the future.

This Hash may be helpful when the user wishes to find a complement to a nucleotide. There is a method that does the same, but this Hash should be faster than a method call, so use it in particular if you need to focus more on speed.

  'A' => 'T',
  'T' => 'A',
  'G' => 'C',
  'C' => 'G',
  'U' => 'A'


This constant will keep all possible DNA nucleotides.

N is also a valid entry, ‘Yarrowia_lipolytica_genome.fa’ includes it. However had,

Only these sequences are allowed in DNA.

To scope to this, do:

  A T G C N




This constant refers to the taxonomy-database from NCBI. This is the file that can be downloaded from the NCBI homepage (actually, the ftp-listing).

Take note that this database, in .tar.gz format, is about 50 MB in size or even larger these days. So only download it if you really need it locally.



An “alias” to the above ^^^ constant.

























bl $BIOROEBE_YAML/aminoacids/amino_acids_monoisotopic_mass_table.yml






This constant may point to a directory such as:







bl $BIOROEBE/yaml/restriction/enzymes/restriction_enzymes.yml



This constants points to the .yml file that will hold information in how to colourize the FASTA sequences.





















We’ll keep the keys downcased.

bl $RUBY_SRC/bioroebe/lib/bioroebe/yaml/aminoacids/amino_acids_three_to_one.yml


This will point to the file amino_acids_average_mass_table.yml.



The path to the file that holds the weight of the nucleotides.




Else hardcode the AminoAcid table here. This may no longer be necessary, though.

  'A' =>  71.03711, 'C' => 103.00919, 'D' => 115.02694,
  'E' => 129.04259, 'F' => 147.06841, 'G' =>  57.02146,
  'H' => 137.05891, 'I' => 113.08406, 'K' => 128.09496,
  'L' => 113.08406, 'M' => 131.04049, 'N' => 114.04293,
  'P' =>  97.05276, 'Q' => 128.05858, 'R' => 156.10111,
  'S' =>  87.03203, 'T' => 101.04768, 'V' =>  99.06841,
  'W' => 186.07931, 'Y' => 163.06333

An alias.



Currently listing 21 AminoAcids from amino_acids.yml

bl $BIOROEBE/yaml/aminoacids/amino_acids.yml





Else simply hardcode the AminoAcid table here.

  'A' =>  71.0788,
  'C' => 103.1388,
  'D' => 115.0886,
  'E' => 129.1155,
  'F' => 147.1766,
  'G' =>  57.0519,
  'H' => 137.1411,
  'I' => 113.1594,
  'K' => 128.1741,
  'L' => 113.1594,
  'M' => 131.1926,
  'N' => 114.1038,
  'P' =>  97.1167,
  'Q' => 128.1307,
  'R' => 156.1875,
  'S' =>  87.0782,
  'T' => 101.1051,
  'V' =>  99.1326,
  'W' => 186.2132,
  'Y' => 163.1760


This denotes the directory for uniprot-files.




opera # Hardcoded value in this case..

ProteinToDNA =


Use an “alias” to the other name.

Fasta =

Add an “alias” constant to class ParseFasta.


Class Method Summary collapse

Instance Method Summary collapse

Class Method Details

.[](i = nil) ⇒ Object



Assign a sequence through the [] method.

Note that some aliases are allowed to this way; see the variants that use self.instance_eval below this method definition.

This method here could be compared to methods such as Integer(). Biopython uses something similar, by the way.

For instance, you can do this too:

Bioroebe << 'ATT'
x = Bioroebe['ATT']
x = Bioroebe << 'ATT'

# File 'lib/bioroebe/sequence/sequence.rb', line 685

def self.[](i = nil)

.ad_hoc_task(this_file = '/root/Bioroebe/') ⇒ Object



This method can be used to specifically run an “ad-hoc” task.

An ad-hoc task is something that we just quickly “hack” together, in order to solve some existing bioinformatics-related problem or another problem that may exist right now.

For instance, in May 2021, this was used for a university course that required us to work with MEGA X and compare different proteins from a phylogenetics point of view.


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 4074

def self.ad_hoc_task(
    this_file = '/root/Bioroebe/'
  require 'bioroebe/fasta_and_fastq/download_fasta.rb'
  require 'bioroebe/fasta_and_fastq/simplify_fasta_header/simplify_fasta_header.rb'
  if this_file.is_a? Array
    this_file = this_file.join(' ')
  cd ::Bioroebe.log_dir? # Make sure we are in the log-directory.
  e 'Now downloading some FASTA files, based on this file: '+
  # ======================================================================= #
  # (1) Download the remote FASTA dataset
  # ======================================================================= #
  download_fasta this_file
  # ======================================================================= #
  # (2) cd into the fasta directory
  # ======================================================================= #
  cd ::Bioroebe.log_dir?+'fasta/'
  # ======================================================================= #
  # (3) batch rename all .fasta files next via simplify-fasta-header.
  # ======================================================================= #
  all_files = Dir['*.fasta']
  all_files.each {|this_fasta_file|

.align_this_string_via_multiple_sequence_alignment(this_string = "PSRARRDAVG--DH--PAVEALP----PQSGPHKKEISFFTVRKEEAADADLWFPS PGGASK--VGQTDNDPQAIKDLP----PQGED------------------------ ") ⇒ Object



This method will simply return an Array.


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 957

def self.align_this_string_via_multiple_sequence_alignment(
    this_string =
  if this_string.is_a? Array
    this_string = this_string.join("\n")
  this_string = this_string.dup if this_string.frozen?
  this_string.delete!(' ')
  splitted = this_string.split("\n")
  return splitted




This method will return all available aminoacids.


Bioroebe.all_aminoacids? # => ["A", "C", "D", "E", "F", "G", "H", "I", "K", "L", "M", "N", "P", "Q", "R", "S", "T", "V", "W", "Y"]


  • (Boolean)

# File 'lib/bioroebe/constants/constants.rb', line 162

def self.all_aminoacids?




This will return an Array with valid DNA nucleotides.



  • (Boolean)

# File 'lib/bioroebe/constants/constants.rb', line 522

def self.allowed_dna_nucleotides?

.amino_acid_average_mass(i) ⇒ Object



The input to this method should be in the form of the one-letter code for aminoacids. Several aminoacids can be input, of course, such as ‘AGL’.

Do note that since as of March 2020 a float will be returned by this method, if the input was found to be a valid aminoacid.

Usage example:

Bioroebe.amino_acid_average_mass('F') # => "147.17660"

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 2008

def self.amino_acid_average_mass(i)
  i = i.split(//) if i.is_a? String
  i = [i] unless i.is_a? Array
  result = {|entry|
    entry = use_this_table[entry].to_f
  return ('%.5f' % result.sum).to_f # ← This is our properly formatted result.

.amino_acid_monoisotopic_mass(this_aminoacid) ⇒ Object



We require the monoisotopic table for this method, and return the corresponding match to the given aminoacid.

The input format should be in the one-letter aminoacid abbreviation.

Invocation example:

Bioroebe.amino_acid_monoisotopic_mass 'L' # => 113.08406
Bioroebe.amino_acid_monoisotopic_mass 'K' # => 128.09496

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 2032

def self.amino_acid_monoisotopic_mass(this_aminoacid)
  # '%.5f' % use_this_table[this_aminoacid].to_f




Feedback which aminoacid-families we know of.

Usage example:

pp Bioroebe.aminoacid_families?; ''


  • (Boolean)

# File 'lib/bioroebe/constants/constants.rb', line 223

def self.aminoacid_families?

.aminoacid_frequency(of_this_sequence = '') ⇒ Object



Usage example:


Would yield the following Hash:

{"M"=>1, "V"=>4, "T"=>9, "D"=>2, "E"=>3, "G"=>4, "A"=>7, "I"=>2, "Y"=>3, "F"=>2, "K"=>2, "R"=>2, "N"=>2, "W"=>1, "S"=>5, "L"=>1}

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 2538

def self.aminoacid_frequency(
    of_this_sequence = ''
  if of_this_sequence.is_a? Array
    of_this_sequence = of_this_sequence.first 
  chars = of_this_sequence.split(//)
  hash = {}
  hash.default = 0
  chars.each {|this_char| hash[this_char] += 1 }
  return hash

.aminoacid_substitution(from_this_sequence = :default) ⇒ Object




# File 'lib/bioroebe/aminoacids/aminoacid_substitution.rb', line 102

def self.aminoacid_substitution(from_this_sequence = :default)




Note that this will return a Hash that looks like this:

{"A"=>{"ala"=>"alanine", "d


  • (Boolean)

# File 'lib/bioroebe/constants/constants.rb', line 995

def self.aminoacids?

.append_what_into(what = 'Hello world!', into = '') ⇒ Object



This method can be used to append content onto a file.


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 1227

def self.append_what_into(
    what = 'Hello world!',
    into = ''
  unless File.exist? into
    base_dir = File.dirname(into)
    unless base_dir
      e rev+
      'No directory exists at '+sdir(base_dir)+
      rev+'. Thus creating it now.'
    e rev+
      'No file exists at '+sfile(into)+rev+
      '. Thus creating it now.'
  end, 'a') { |file|
    file << what




Query as to which aminoacid we will colourize, if any at all.


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 1291

def self.array_colourize_this_aminoacid

.atomic_composition(of = 'GGGGA') ⇒ Object



This method will return the composition of atoms in a given protein, via Hash, such as:

{"C"=>11, "H"=>19, "N"=>5, "O"=>6, "S"=>0}

The Hash keeps track of 11 C atoms, 19 H atoms, 5 N atoms, 6 O atoms and 0 S atoms.

This hash can then be formatted via the method:


Which can be found below.

Presently this method works on aminoacids only, but in theory the code could be extended to work with DNA nucleotides and RNA nucleotides as well.

Either way, the one letter abbreviation should be used as input to this method.

When we use aminoacids, we need to remember that a peptide bond deducts 1x H₂O (water). This will have to be deducted from the formula, but only if it is an internal aminoacid. In other words, the only two aminoacids that will behave differently, are the first one (since it will miss one -OH group) and the last aminoacid (as this one will lack a -H molecule.

Remember that the input sequence to this method should be the one-letter code for the aminoacid sequence at hand.


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 2145

def self.atomic_composition(
    of = 'GGGGA' # ← This should be the aminoacid sequence.
    require 'chemistry_paradise/split_molecule_names.rb'
    require 'chemistry_paradise/toplevel_methods/remove_this_molecule_from.rb'
  rescue LoadError
    if is_on_roebe?
      puts 'Two files from the chemistry_paradise gem are not available.'
  # ======================================================================= #
  # Load up the molecular formula for each aminoacid next. This will
  # be used as our reference-point for calculating things such as the
  # composition, or weight.
  # ======================================================================= #
  dataset_molecular_formula_for_the_aminoacids = YAML.load_file(
  if of.is_a?(Array)
    if of.empty?
      of = 'GGGGA' # In this case reinstate the default.
      if of.first.is_a?(String) and of.first.size > 1
        of = of.first.split(//) # Split it on a per-character basis here.
  if of.is_a? String
    of = of.split(//)
  unless of.is_a? Array
    of = [of]
  hash_keeping_track_of_the_atomic_composition = {}
  # ======================================================================= #
  # Build up the default values, for the atoms C, H, N, O and S.
  # ======================================================================= #
  hash_keeping_track_of_the_atomic_composition['C'] = 0
  hash_keeping_track_of_the_atomic_composition['H'] = 0
  hash_keeping_track_of_the_atomic_composition['N'] = 0
  hash_keeping_track_of_the_atomic_composition['O'] = 0
  hash_keeping_track_of_the_atomic_composition['S'] = 0
  # ======================================================================= #
  # Next obtain the formula from the ChemistryParadise project. We
  # do so by iterating over the given input, and we assume that
  # this input is always an Array.
  # ======================================================================= # {|this_amino_acid, position_of_that_aminoacid|
    # ===================================================================== #
    # Next, we have to obtain the formula for this amino acid.
    # ===================================================================== #
    this_amino_acid = AMINO_ACIDS_ENGLISH[this_amino_acid]
    formula_for_this_amino_acid = dataset_molecular_formula_for_the_aminoacids[this_amino_acid]
    # ===================================================================== #
    # The next case-menu will handle the position of the aminoacid at hand.
    # We will skip doing so if there is only one aminoacid though.
    # ===================================================================== #
    if of.first.to_s.size > 1
      case position_of_that_aminoacid # case tag
      when 0 # This is the first aminoacid. It loses only one 'OH' group.
        formula_for_this_amino_acid = 
          ::ChemistryParadise.remove_this_molecule_from('OH', formula_for_this_amino_acid)
      when (of.size - 1) # This is the last entry. It loses only one 'H' group.
        formula_for_this_amino_acid = 
          ::ChemistryParadise.remove_this_molecule_from('H', formula_for_this_amino_acid)
        # ================================================================= #
        # Else it will lose a full H₂O group.
        # ================================================================= #
        formula_for_this_amino_acid = 
          ::ChemistryParadise.remove_this_molecule_from('H2O', formula_for_this_amino_acid)
    array_chemical_formula = ::ChemistryParadise.split_this_molecular_formula_into_a_hash(
    array_chemical_formula.each {|molecule_and_number| # e. g. 'H13'
      if molecule_and_number =~ /\d+/ # If it has at the least one number.
        molecule_and_number =~ /([A-Z]+)(\d{1,2})/ # See:
        molecule = $1.to_s.dup
        n_times  = $2.to_s.dup.to_i
        hash_keeping_track_of_the_atomic_composition[molecule] += n_times
      else # else it must be 1, since there is no other number, such as 'N'.
        hash_keeping_track_of_the_atomic_composition[molecule_and_number] += 1
  return hash_keeping_track_of_the_atomic_composition

.automatically_rename_this_fasta_file(fasta_file) ⇒ Object



This method will automatically (try to) rename an existing fasta file, by tapping into the method called .return_new_filename_based_on_fasta_identifier().


# File 'lib/bioroebe/toplevel_methods/fasta_and_fastq.rb', line 135

def self.automatically_rename_this_fasta_file(fasta_file)
  fasta_file = [fasta_file].flatten.compact
  fasta_file.each {|this_fasta_file|
    if File.exist? this_fasta_file
      new_filename = return_new_filename_based_on_fasta_identifier(this_fasta_file)
      erev "Renaming #{sfile(this_fasta_file)}#{rev} "\
           "to #{sfile(new_filename)} #{rev}next."
      Bioroebe.rename(this_fasta_file, new_filename)




This method will return an Array of all available blosum matrices.

Example output:

["blosum45", "blosum50", "blosum62", "blosum80", "blosum90", "blosum_matrix"]


  • (Boolean)

# File 'lib/bioroebe/blosum/blosum.rb', line 78

def self.available_blosum_matrices?
  Bioroebe::Blosum.available_blosum_files?.map {|entry|






  • (Boolean)

# File 'lib/bioroebe/codons/show_codon_tables.rb', line 125

def self.available_codon_tables?
  ::Bioroebe::CodonTables.definitions?.values # Do not sort this.

.base_composition(i = '52%GC') ⇒ Object



This method can be used to query the composition of a given DNA sequence, that is, in percentage, the values for A, T, C and G.

This method will then return a Hash, consisting of the percentage values of A, T, C and G in the given DNA sequence at hand.

Note that the input to this method has to include a ‘%’ character, at the least up until March 2020. Past March 2020 this requirement was dropped, but I still think it is visually more elegant to include a ‘%’ character.


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 3931

def self.base_composition(
    i = '52%GC'
  if i.is_a? Array
    if i.empty?
      i = '52%GC' # Default value.
      i = i.join(' ').strip
  # ======================================================================= #
  # Add support for Files here.
  # ======================================================================= #
  if i and File.exist?(i)
    i = File.readlines(i).reject {|line| line.start_with? '>' }.join("\n").delete("\n")
  # ======================================================================= #
  # We must use a Hash for this.
  # ======================================================================= #
  hash = {
    'A' => 0,
    'T' => 0,
    'C' => 0,
    'G' => 0,
  if i.include? '%'
    splitted = i.split('%').map(&:strip)
    frequency = splitted.first.to_i
    opposite_frequency = 100 - frequency
    characters = splitted.last.split(//)
    characters.each {|this_nucleotide|
      hash[this_nucleotide] = frequency / 2
    # ===================================================================== #
    # Next calculate the missing nucleotides:
    # ===================================================================== #
    missing_nucleotides = {|key, value|
      value == 0
    missing_nucleotides.each_pair {|this_nucleotide, value|
      hash[this_nucleotide] = opposite_frequency / 2
    frequency =
    chars = i.chars
    chars.each { |entry| frequency[entry] += 1 }
    sum = frequency.values.sum
    frequency.each_pair {|this_nucleotide, value|
      hash[this_nucleotide] = ((value * 100.0) / sum).round(2)
  return hash




This method is only useful for windows. We will use “ocra” to create various .exe files that have the desired widgt-functionality.

Note that the functionality depends on the roebe-gem.


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 2860

def self.batch_create_windows_executables
    require 'roebe/custom_methods/module.rb'
  rescue LoadError; end
  array_these_files =  %w(
  array_these_files.each {|this_file|






  • (Boolean)

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 164

def self.be_verbose?

.bisulfite_treatment(i) ⇒ Object



Simply convert all C into U. The underlying idea here is that bilsufite will convert unmethylated Cytosines into Uracil.

Usage example:


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 2845

def self.bisulfite_treatment(i)
  if i.is_a? Array
    i = i.join('').strip

.blast_neighborhood(this_mer = 'CTC', optional_apply_filter_for_score_higher_than = nil) ⇒ Object



The second argument to this method is a score-filter, e. g. to select only entries that have a score higher than 1.


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 4271

def self.blast_neighborhood(
    this_mer                                    = 'CTC',
    optional_apply_filter_for_score_higher_than = nil
  if this_mer.is_a? Array
    this_mer = this_mer.first
  if this_mer.nil?
    this_mer = 'CTC' # Set the same default as above.
  match_score     =  2
  mis_match_score = -2
  # ======================================================================= #
  # Next use an Array of sequences that we will compare.
  # ======================================================================= #
  compare_these_sequences = %w(
  compare_these_sequences.each {|this_sequence|
    score = 0
    chars = this_sequence.chars
    first_char  = chars[0]
    second_char = chars[1]
    third_char  = chars[2]
    if first_char == this_mer[0]
      # =================================================================== #
      # Found the first match.
      # =================================================================== #
      score += match_score
      # =================================================================== #
      # else it must be a mismatch
      # =================================================================== #
      score += mis_match_score
    if second_char == this_mer[1]
      # =================================================================== #
      # Found the first match.
      # =================================================================== #
      score += match_score
      # =================================================================== #
      # else it must be a mismatch
      # =================================================================== #
      score += mis_match_score
    if third_char == this_mer[2]
      # =================================================================== #
      # Found the first match.
      # =================================================================== #
      score += match_score
      # =================================================================== #
      # else it must be a mismatch
      # =================================================================== #
      score += mis_match_score
    if optional_apply_filter_for_score_higher_than
       if (score.to_i > optional_apply_filter_for_score_higher_than)
        e "#{this_sequence}: score of "\
      e this_sequence+': score of '+






  • (Boolean)

# File 'lib/bioroebe/constants/constants.rb', line 899

def self.blosum_directory?

.blosum_matrix(i = FILE_BLOSUM_MATRIX) ⇒ Object




# File 'lib/bioroebe/constants/constants.rb', line 801

def self.blosum_matrix(i = FILE_BLOSUM_MATRIX)

.calculate_exponential_growth(number_of_cells = 10, number_of_divisions = 10) ⇒ Object



This method can be used to calculate how many bacteria will exist after n cell divisions (provided that we know, and supply to this method, how many bacteria existed when we started our calculation).


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 4774

def self.calculate_exponential_growth(
    number_of_cells     = 10,
    number_of_divisions = 10
  if number_of_cells.nil?
    number_of_cells = 10 # Default value.
  if number_of_divisions.nil?
    number_of_divisions = 10 # Default value.
  # ======================================================================= #
  # === Hashes
  # Handle Hash as input given.
  # ======================================================================= #
  if number_of_cells.is_a? Hash
    if number_of_cells.has_key? :n_divisions
      number_of_divisions = number_of_cells.delete(:n_divisions)
    if number_of_cells.has_key? :number_of_cells
      number_of_cells = number_of_cells.delete(:number_of_cells)
    elsif number_of_cells.has_key? :n_cells
      number_of_cells = number_of_cells.delete(:n_cells)
  # ======================================================================= #
  # We need numbers, aka integers - there are no "1.3" cells.
  # ======================================================================= #
  number_of_cells     = number_of_cells.to_i
  number_of_divisions = number_of_divisions.to_i
  total_amount_of_cells = 0
  total_amount_of_cells = number_of_cells * (2 ** number_of_divisions)
  return total_amount_of_cells

.calculate_levensthein_distance(string1 = 'TTACCC', string2 = 'TTTCCC', be_verbose = true) ⇒ Object



The following method is based on, slightly modified.

To test this code, do:

[ ['kitten','sitting'], ['saturday','sunday'], ["rosettde", "raisethyrd"] ].each { |s,t|
  puts "calculate_levensthein_distance('#{s}', '#{t}') = #{Bioroebe.calculate_levensthein_distance(s, t)}"

However had, rubygems has a levensthein variant too.


# File 'lib/bioroebe/calculate/calculate_levensthein_distance.rb', line 27

def self.calculate_levensthein_distance(
    string1    = 'TTACCC',
    string2    = 'TTTCCC',
    be_verbose = true
  case be_verbose
  when :be_quiet
    be_verbose = false
  if string1.is_a?(Array) and (string1.size > 1)
    string2 = string1.shift
    string1 = string1.first
  elsif string1.is_a?(String) and string1.include?(' ')
    splitted = string1.split(' ')
    string2  = splitted.last
    string1  = splitted.first
  m = string1.length
  n = string2.length
  return m if n == 0 # Stop at 0.
  return n if m == 0 # Stop at 0.
  arrays = { }
  # ======================================================================= #
  # Initialize the variable arrays next:
  # ======================================================================= #
  (0 .. m).each {|i| arrays[i][0] = i}
  (0 .. n).each {|j| arrays[0][j] = j}
  # ======================================================================= #
  # Now, iterate through:
  # ======================================================================= #
  (1 .. n).each {|j|
    (1 .. m).each {|i|
      arrays[i][j] = 
        if string1[i-1] == string2[j-1] # adjust index into string
          arrays[i-1][j-1]       # no operation required
           [ arrays[i-1][j]+1,   # deletion     operation
             arrays[i][j-1]+1,   # insertion    operation
             arrays[i-1][j-1]+1, # substitution operation
  result = arrays[m][n]
  if be_verbose
    e rev+'The two strings '+simp(string1.to_s)+rev+' and '+
      simp(string2.to_s)+rev+' have n differences ('+
      steelblue('edit distance')+rev+'):'
    e "  #{simp(result.to_s)}"
  return result

.calculate_melting_temperature_for_more_than_thirteen_nucleotides(i) ⇒ Object



An alias exists for this method, called Bioroebe.melting_Temperature().

Usage example for the latter:

x = Bioroebe.melting_temperature('CCGTGTCGTACATCG')

# File 'lib/bioroebe/calculate/calculate_melting_temperature_for_more_than_thirteen_nucleotides.rb', line 269

def self.calculate_melting_temperature_for_more_than_thirteen_nucleotides(i)

.calculate_n50_value(i = [ 1989, 1934, 1841, 1785, 1737, 1649, 1361, 926, 848, 723 ]) ⇒ Object



This method will calculate the N50 value of the given input. The input to this method should be a sorted Array.


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 3060

def self.calculate_n50_value(
    i = [
      1989, 1934, 1841,
      1785, 1737, 1649,
      1361,  926,  848,
  # ======================================================================= #
  # The following conversion is necessary because ARGV will contain only
  # String objects, not integer-values.
  # ======================================================================= #! {|entry| entry.to_i }
  calculate_sum_for_the_loop = 0
  sum = i.sum
  half = sum / 2.0
  find_the_proper_contig = nil
  i.each {|this_number|
    calculate_sum_for_the_loop += this_number
    # ===================================================================== #
    # Compare the temporary sum with the half-sum.
    # ===================================================================== #
    if calculate_sum_for_the_loop > half
      find_the_proper_contig = this_number
  return find_the_proper_contig

.calculate_original_amount_of_cells_of_exponential_growth(number_of_cells = 1600, number_of_divisions = 5) ⇒ Object



The first argument, number_of_cells, means “how many cells do we have now/currently”. This is necessary, in order to calculate how many cells we used to have initially.


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 4816

def self.calculate_original_amount_of_cells_of_exponential_growth(
    number_of_cells     = 1600, # 1600 cells to start with.
    number_of_divisions =    5  #    5 generations by default.
  number_of_cells     = number_of_cells.to_i
  number_of_divisions = number_of_divisions.to_i
  initial_amount_of_cells_was = 0
  initial_amount_of_cells_was = number_of_cells / ( 2 ** number_of_divisions )
  return initial_amount_of_cells_was

.calculate_the_frequencies_of_this_species(i = :homo_sapiens) ⇒ Object




# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 2477

def self.calculate_the_frequencies_of_this_species(
    i = :homo_sapiens
  require 'bioroebe/sequence/dna.rb'
  require 'yaml'
  if i.nil?
    i = :default
  if i and i.is_a?(Array) and i.empty?
    i << :homo_sapiens
  hash_aminoacids = {}
  hash_aminoacids.default = 0
  if i.is_a? Array
    i = i.first
  case i.to_sym
  # ======================================================================= #
  # === :homo_sapiens
  # ======================================================================= #
  when :homo_sapiens,
    i = "#{project_base_directory?}"\
  hash = YAML.load_file(i)
  # "GAC"=>25.1
  hash.each_pair {|key, value|
    this_aminoacid = Bioroebe.to_aa(key)
    hash_aminoacids[this_aminoacid] += value
  # ======================================================================= #
  # Convert it into percent:
  # ======================================================================= #
  hash_aminoacids.each_pair {|key, value_for_percentage|
    value_for_percentage = ((value_for_percentage * 100.0) / 1000.0).round(3).to_s
    value_for_percentage = '%.2f' % value_for_percentage
    e '  '+
      steelblue(key).to_s+' '+

.calculate_weight_of_the_aminoacids_in_this_fasta_file(fasta_file) ⇒ Object



This method will return a Hash containing the weight of the aminoacids in a .fasta file.

Usage example:

x = Bioroebe.calculate_weight_of_the_aminoacids_in_this_fasta_file('viruses.fa')

This may yield a Hash such as the following:

{ "sp|P23046|NSP5_ROTBV"  => 21647.5341,
  "sp|Q81835|SHDAG_HDVU2" => 22030.6392,
  "sp|A5HBD7|ST_POVWU"    => 23433.3773,
  "sp|Q91FT8|234R_IIV6"   => 21076.778 }

# File 'lib/bioroebe/toplevel_methods/fasta_and_fastq.rb', line 42

def self.calculate_weight_of_the_aminoacids_in_this_fasta_file(fasta_file)
  if File.exist? fasta_file
    hash = {}
    results = Bioroebe.parse_fasta_quietly(fasta_file)
    short_headers = results.short_headers?
    sequences = results.sequences?
    short_headers.each_with_index {|entry, index|
      sum = 0
      this_sequence = sequences[index]
      # Next, convert this sequence into the corresponding mass.
      this_sequence.chars.each {|this_specific_aminoacid|
        sum += Bioroebe.weight_of_this_aminoacid?(this_specific_aminoacid)
      hash[entry] = sum.round(4)
    e 'No file exists at '+fasta_file.to_s+'.'

.can_base_pair_with?(a, b) ⇒ Boolean



Usage example:

Bioroebe.can_base_pair_with?('A','T') # => true
Bioroebe.can_base_pair_with?('A','G') # => false


  • (Boolean)

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 4916

def self.can_base_pair_with?(a, b)
  ::Bioroebe.partner_nucleotide(a) == b

.cat(i = nil) ⇒ Object

# (cat tag)

A variant of cat to use here.


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 5012

    i = nil
  if i.is_a? Array
    i = i.first
  if i
    i = convert_global_env(i) if i.include? '$'
    i = Dir['*'][i.to_i - 1] if i =~ /^\d+$/
  if i.nil?
    erev 'Please provide an argument to (the name of a file)'
  # ======================================================================= #
  # === Handle directories next
  # ======================================================================= #
  elsif i
    erev "We can not read from `#{sdir(i)}#{rev}` as it is a directory."
  # ======================================================================= #
  # Else the File will exist in this clause:
  # ======================================================================= #
  elsif File.exist?(i)
    _ = File.extname(i).delete('.')
    case _ # case tag
    # ===================================================================== #
    # === fasta
    # ===================================================================== #
    when 'fasta',
      e 'This is a fasta file, so rather than cat-ing the content,'
      e 'we will send this dataset to the ParseFasta class.'
      require 'bioroebe/fasta_and_fastq/parse_fasta/parse_fasta.rb'
    else # The default here.
      e "Now displaying the file `#{sfile(i)}`."
      # e
      # ^^^ Or we could use the above. We have to reconsider this one day.
      File.readlines(i).each {|line| e "  #{line.chomp}" } # With a bit of padding.
  else # else the file does not exist.
    e "#{swarn('Trying to display the file `')}#{sfile(i)}#{swarn('`')}"
    e swarn('but it does not exist.')

.change_directory(i = '$HOME', be_verbose = false) ⇒ Object



This method allows us to change the directory. is an alias to the method here.


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 4210

def self.change_directory(
    i          = '$HOME',
    be_verbose = false
  case be_verbose
  # ======================================================================= #
  # === :do_report_current_directory
  # ======================================================================= #
  when :do_report_current_directory,
    be_verbose = true
  case i # Do some sanitizing here. (case tag)
  # ======================================================================= #
  # === :home_directory
  # ======================================================================= #
  when :home_directory,
       nil # ← Nil is also assumed to refer to this :default value.
    # ===================================================================== #
    # In this case we will try to cd into the base-directory of the
    # Bioroebe shell.
    # ===================================================================== #
    i = log_dir?
  # ======================================================================= #
  # === :download_dir
  # ======================================================================= #
  when :download_dir,':download_dir',
    i = download_dir?
  # ======================================================================= #
  # Bioroebe.save_dir? is defined in bioroebe/toplevel_methods/store_here.rb.
  # ======================================================================= #
  when 'base',
    # ===================================================================== #
    # Enter the main log dir, unless a file exists with the same name.
    # ===================================================================== #
    i = save_dir? unless File.exist?(i.to_s) # .to_s to avoid Symbols here.
  i = i.dup if i.is_a?(String) and i.frozen?
  i << '/' unless i.end_with? '/'
  if i
    e sdir(i) if be_verbose # Also colourize the directory and output it.
    if be_verbose
      erev "No directory called `#{sdir(i)}#{rev}` exists,"
      erev 'thus we can not cd to this target.'





# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 1282

def self.clear_array_colourize_this_aminoacid
  @array_colourize_this_aminoacid = []





# File 'lib/bioroebe/codons/codons.rb', line 256

def self.clear_stop_codons
  @stop_codons = []

.cleave(with = :with_trypsin, i = ARGV) ⇒ Object


Bioroebe.cleave (cleave tag)

This is the general entry-point for “cleave-related” activities, such as cleaving a polypeptide or a DNA strand via an enzyme.


# File 'lib/bioroebe/cleave_and_digest/cleave.rb', line 56

def self.cleave(
    with = :with_trypsin,
    i    = ARGV
  case with
  # ======================================================================= #
  # === :with_trypsin
  # ======================================================================= #
  when :with_trypsin,

.cleave_with_trypsin(this_sequence = ARGV) ⇒ Object



Trypsin cleaves peptides on the C-terminal side of lysine and arginine amino acid residues. If a proline residue is on the carboxyl side of the cleavage site, the cleavage will not occur. If an acidic residue is on either side of the cleavage site, the rate of hydrolysis has been shown to be slower.

This method will return an Array.


# File 'lib/bioroebe/cleave_and_digest/cleave.rb', line 21

def self.cleave_with_trypsin(
    this_sequence = ARGV
  # ======================================================================= #
  # === Handle Arrays first
  # ======================================================================= #
  if this_sequence.is_a? Array
    this_sequence = this_sequence.first
  array_cleave_positions = [] # This is the Array that will be returned.
  subrange = ''.dup
  this_sequence.size.times {|index|
    this_char = this_sequence[index, 1]
    case this_char # case tag
    when 'K','R'
      subrange << this_char
      next_char_is = this_sequence[index+1, 1]
      unless next_char_is == 'P' # Exclude Proline.
        array_cleave_positions << subrange
        subrange = ''.dup
      subrange << this_char
  array_cleave_positions << subrange
  return array_cleave_positions

.cliner(use_this_token = :default_token, how_many_times = 80, use_this_colour = nil) ⇒ Object



The first character denotes which token we will use, such as ‘#’, for the line that is to be displayed.


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 2578

def self.cliner(
    use_this_token  = :default_token,
    how_many_times  = 80,
    use_this_colour = nil
  require 'bioroebe/colours/colours.rb'
  if use_this_token.is_a? Hash
    # ===================================================================== #
    # === :length
    # ===================================================================== #
    if use_this_token.has_key? :length
      how_many_times = use_this_token.delete(:length)
    if use_this_token.is_a? Hash
      # =================================================================== #
      # === :token
      # =================================================================== #
      if use_this_token.has_key? :token
        use_this_token = use_this_token.delete(:token)
    use_this_token = :default if use_this_token.is_a? Hash
  # ======================================================================= #
  # The following case-when menu must come after the check for Hashes
  # above.
  # ======================================================================= #
  case use_this_token
  when :default_token, :default
    use_this_token = '='
  # ======================================================================= #
  # === handle blocks next
  # ======================================================================= #
  if block_given?
    yielded = yield
    if yielded.is_a?(Hash)
      # =================================================================== #
      # === :colour
      # =================================================================== #
      if yielded.has_key? :colour
        use_this_colour = yielded[:colour]  
      # =================================================================== #
      # === :colours
      # =================================================================== #
      elsif yielded.has_key? :colours
        use_this_colour = yielded[:colours]
    #  cliner(use_this_token, how_many_times)
  if use_this_colour
    e ::Colours.send(use_this_colour, use_this_token * how_many_times)
    e use_this_token * how_many_times

.codon_frequencies_of_this_sequence(i = ARGV) ⇒ Object



Usage example:


Will yield this Hash:

{"AAA"=>5, "ATG"=>4, "CCA"=>1, "CCG"=>1, "TTA"=>1, "CCT"=>1, "GCA"=>1, "GTG"=>1, "GGG"=>1, "GGC"=>1}

# File 'lib/bioroebe/codons/show_codon_usage.rb', line 198

def self.codon_frequencies_of_this_sequence(i = ARGV) { :be_quiet }.result?




The input to this method should ideally be a String. It will be assumed to be a RNA string, e. g. mRNA. Thus, all T are replaced with U by default. This can be toggled via the second argument of this method.

This method will return a Hash.

Usage example:

Bioroebe.codon_frequency_of_this_string 'ATTCGTACGATCGACTACTACT' # => {"UAC"=>2, "GAC"=>1, "AUC"=>1, "ACG"=>1, "CGU"=>1, "AUU"=>1}

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 917

def self.codon_frequency_of_this_string(
    automatically_convert_into_a_RNA_sequence = true
  i = i.join if i.is_a? Array
  if automatically_convert_into_a_RNA_sequence
    i = i.dup if i.frozen?!('T','U')
  scanned = i.scan(/.../)
  tally = scanned.tally
  # ======================================================================= #
  # We still have to sort it.
  # ======================================================================= #
  sorted_hash = Hash[tally.sort_by {|key, value| value }.reverse]
  return sorted_hash




This method will return the “codon table dataset”, as a Hash.

This Hash will contain entries like this:

{"TAA"=>"*", "TGA"=>'*',"CCA"=>"P", ...

and so forth.



  • (Boolean)

# File 'lib/bioroebe/codons/codon_table.rb', line 39

def self.codon_table_dataset?




Query method to return the currently used codon table.



  • (Boolean)

# File 'lib/bioroebe/codons/codon_table.rb', line 83

def self.codon_table_in_use?




This method will return all codon tables that we have registered.

This is probably not so terribly useful for most projects, but in the event that you do need all codon tables, you can use this method.

The result will be a Hash having key->value pairs such as:

"9" => {"TAA"=>"*", "TAG"=>"*"

# File 'lib/bioroebe/codons/codon_tables.rb', line 30

def self.codon_tables
  require 'bioroebe/requires/require_yaml.rb'
  hash = {}
  _ = "#{yaml_directory?}codon_tables/*.yml"
  all_files = Dir[_].sort
  all_files.each {|yaml_file|
    next if yaml_file.end_with? 'overview.yml' # We reject this one here.
    dataset = YAML.load_file(yaml_file)
    entry_number = File.basename(yaml_file).delete_suffix('.yml')
    dataset = { entry_number => dataset}

.codons_for_this_aminoacid?(i = ARGV) ⇒ Boolean



This method will return all possible DNA codons for a specific aminoacid, as an Array.

So for example, for the aminoacid serine, this method would return an Array containing all 6 codons that code for this aminoacid (if the eukaryotic codon table is used, which also includes humans).

This method supports to query only ONE aminoacid at a given time.

Currently the method relies on the file called “codons_of_the_aminoacids.yml”. In the future, the method here will probably be changed to add support for different codon tables.

Specific invocation examples:


To test this for another organism, try:

Bioroebe.decode_this_aminoacid 'K' # => ["AAA", "AAG"]


  • (Boolean)

# File 'lib/bioroebe/codons/codons.rb', line 322

def self.codons_for_this_aminoacid?(
    i = ARGV
  # ======================================================================= #
  # First, convert the input a bit and sanitize it.
  # ======================================================================= #
  i = i.first if i.is_a? Array
  if i.is_a?(String) and i.start_with?(':')
    i = i.delete(':').to_sym
  case i # case tag
  when :default,
    i = :lysine
  if i.is_a? Symbol
    # ===================================================================== #
    # === Convert e. g. :serine into 'ser'
    # ===================================================================== #
    _ = i.to_s.downcase[0 .. 2]
  # ======================================================================= #
  # Next we must use the one-letter abbreviation, and then find all
  # entries that match to the given input at hand.
  # @codon_table_dataset is a Hash and will have these key->value
  # entries:
  #   "TTC" => "F"
  # ======================================================================= #
  result = {|key, value|
    value == i
  return result.keys

.colourize_aa(i, array_colourize_these_aminoacids = array_colourize_this_aminoacid? ) ⇒ Object



Use this method if you wish to colourize an aminoacid, in a red colour.

The input should be the specific aminoacid sequence in question that you wish to see being colourized here.

This currently only works for aminoacids, and only in red. Perhaps at a later time it will become more flexible, but for now, it will be exclusive for aminoacids alone.

Usage example:

puts Bioroebe.colourize_aa 'STGYGGCTR', 'S T Y'

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 1924

def self.colourize_aa(
    array_colourize_these_aminoacids = array_colourize_this_aminoacid?
  if array_colourize_these_aminoacids.is_a? String
    array_colourize_these_aminoacids = array_colourize_these_aminoacids.split(' ') # Split it into an Array.
  unless array_colourize_these_aminoacids.empty?
    if i.nil?
      puts 'You first have to assign a sequence.'
      if i.chars.any? {|entry| array_colourize_these_aminoacids.include? entry }
        # =================================================================== #
        # Ok, we have established a need to colourize the result.
        # =================================================================== #
        array_colourize_these_aminoacids.each {|colour|
          i.gsub!(/(#{colour})/, swarn('\\1')+rev)
  end if use_colours? # But only if we use colours.
  return i

.colourize_this_aminoacid_sequence_for_the_commandline(i) ⇒ Object



This method uses some hardcoded colour assignments to the 20 different aminoacids.

Usage example:

puts Bioroebe.colourize_this_aminoacid_sequence_for_the_commandline('NLKRSPTHY')

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 1717

def self.colourize_this_aminoacid_sequence_for_the_commandline(i)
  if i.is_a? Array
    i = i.join
  array_of_allowed_aminoacids = %w( A R N D B C E Q Z G H I L K M F P S T W Y V )
  _ = ''.dup
  splitted = i.chars
  splitted.each {|this_aminoacid|
    case this_aminoacid
    when *array_of_allowed_aminoacids
      this_aminoacid = send(dataset[this_aminoacid.to_s], this_aminoacid)
    # else # else it will not be colourized.
    _ << this_aminoacid
  return _

.colourize_this_fasta_dna_sequence(i = nil, &block) ⇒ Object



This toplevel method can be used to colourize a FASTA (DNA) sequence, e. g. “ATGCGCGTATTA” and so forth.

Note that this is intended for the commandline, that is to be displayed on e. g. a KDE Konsole terminal.

Usage examples:

puts Bioroebe.colourize_this_fasta_dna_sequence('ATGCGCATGCGCGTATTAGTATTAATGCGCGTATTAATGCGCGTATTA')
puts Bioroebe.colourize_this_fasta_dna_sequence('ATGCGCATGCGCGTATTAGTATTAATGCGCGTATTAATGCGCGTATTA') { :with_ruler }
puts Bioroebe.colourize_this_fasta_dna_sequence('TGCGCGTATTAGTATTAATGCGCGTATTAATGCGCGTATTA') { :with_ruler_steelblue_colour }

# File 'lib/bioroebe/toplevel_methods/fasta_and_fastq.rb', line 232

def self.colourize_this_fasta_dna_sequence(
    i = nil,
  unless ::Bioroebe.respond_to?(:ruler_return_as_string_without_colours)
    require 'bioroebe/misc/ruler.rb'
  if i.nil?
    e 'Please provide a valid FASTA sequence as input to '\
  if i.is_a? Array
    # ===================================================================== #
    # Arrays will be joined together.
    # ===================================================================== #
    i = i.join(' ').strip
  # ======================================================================= #
  # Check for existing files next:
  # ======================================================================= #
  if i and File.file?(i)
    i =
  original_input = i.dup
  i = i.dup # Always dup it here.
  if i.is_a? String
    # ===================================================================== #
    # The colours are either defined in a file called
    # 'colourize_fasta_sequences.yml' or they are simply hardcoded.
    # The preferred (and thus default) way is to simply make use
    # of that .yml file. That works on my home system, so it
    # should work for other people as well.
    # ===================================================================== #
    if use_colours?
      if File.exist? this_file
        dataset_for_the_colours = YAML.load_file(this_file)
        dataset_for_the_colours.each_pair {|this_nucleotide, this_colour_to_be_used|
            Colours.send(this_colour_to_be_used, this_nucleotide)+
        i.gsub!(/A/, "#{teal('A')}#{rev}")
        i.gsub!(/C/, "#{slateblue('C')}#{rev}")
        i.gsub!(/G/, "#{royalblue('G')}#{rev}")
        i.gsub!(/T/, "#{steelblue('T')}#{rev}")
        i.gsub!(/U/, "#{steelblue('U')}#{rev}") # Uracil is just the same as Thymine.
  # ======================================================================= #
  # === Handle blocks next
  # ======================================================================= #
  if block_given?
    yielded = yield
    case yielded
    # ===================================================================== #
    # === with_ruler
    # ===================================================================== #
    when :with_ruler,
    else # Assume something like:
         #   :with_ruler_steelblue_colour
      if yielded.to_s.include? 'colo' # This assumes "colour" or "color".
        use_this_colour = yielded.to_s.sub(/_colou?r/,'').
        this_string = send(use_this_colour,
  return i

.colours(enable_or_disable = '+') ⇒ Object



This method can be used to quickly enable or disable colours, by passing ‘+’ or ‘-’.


# File 'lib/bioroebe/colours/colours.rb', line 131

def self.colours(
    enable_or_disable = '+'
  case enable_or_disable.to_s
  when '+',
  when '-',

.compacter(i = ARGV) ⇒ Object



Note that this variant will NEVER ask for user-input of the Bioroebe::Compacter class.


# File 'lib/bioroebe/utility_scripts/compacter/compacter.rb', line 243

def self.compacter(
    i = ARGV
  ) { :do_not_ask_for_user_input }

.complement(i = nil) ⇒ Object



This method will return the complementary DNA strand.

We will use possibilities though.

Usage example:

Bioroebe.complement 'ATGGGTCCC' # => "TACCCAGGG"

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 3997

def self.complement(
    i = nil
  # ======================================================================= #
  # Refer to the main Hash.
  # ======================================================================= #
  result = ''.dup
  i = i.first if i.is_a? Array
  if i
    if File.exist?(i)
      i = File.readlines(i).join(' ').strip
    i.each_char { |char|
      char = char.upcase
      if hash.has_key? char
        result << hash[char]
        case char.downcase # case tag
        when 'n' # Means any.
          result << '(A/T/G/C)'
        when 'r' # Means a purine.     (larger)
          result << '(A/G)'
        when 'y' # Means a pyrimidine. (smaller)
          result << '(T/C)'
    return result

.complementary_dna_strand(i = ARGV) ⇒ Object



This method will simply return the corresponding (complementary) DNA strand.

Usage example:

Bioroebe.complementary_dna_strand('ATCATCATC') # => "TAGTAGTAG"

# File 'lib/bioroebe/nucleotides/complementary_dna_strand.rb', line 152

def self.complementary_dna_strand(i = ARGV)

.complementary_rna_strand(i) ⇒ Object



This method will simply return the corresponding (complementary) RNA strand.

Usage example:

Bioroebe.complementary_rna_strand('ATCATCATC') # => "UAGUAGUAG"

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 588

def self.complementary_rna_strand(i)
  if i.is_a? Array
    i = i.first
  hash = partner_nucleotide_hash {|entry| hash[entry] }'T','U')

.compseq(i = ARGV) ⇒ Object




# File 'lib/bioroebe/utility_scripts/compseq/compseq.rb', line 514

def self.compseq(i = ARGV) { :disable_colours_and_be_quiet }.result_as_string?

.contains_an_inverted_repeat?(i = 'TTACGAAAAAACGTAA') ⇒ Boolean



We assume an inverted repeat to exist if at the least 2 nucleotides match to one another in the reverse, so a total of 4 matching nucleotides. This assumption may not necessarily be correct and we may have to fine-tune this at a later time.

For testing purpose, the sequence ‘TTACGAAAAAACGTAA’ can be used.



  • (Boolean)

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 532

def self.contains_an_inverted_repeat?(
    i = 'TTACGAAAAAACGTAA' # This is in the 5'→3' direction.
  contains_an_inverted_repeat = false
  longest_stretch = 0
  current_stretch = 0
  halfed_position = i.size / 2
  both_sides = [
    i[0 .. (halfed_position-1)],
    i[halfed_position .. -1]
  # ======================================================================= #
  # Now that we have both sides, we will try to match them. First reverse
  # the second, though.
  # ======================================================================= #
  first  = both_sides[0]
  second = both_sides[1].reverse # Work via the reverse sequence.
  first.chars.each_with_index {|this_nucleotide, index|
    if can_base_pair_with?(second[index], this_nucleotide)
      current_stretch += 1
      longest_stretch = current_stretch if current_stretch > longest_stretch 
      current_stretch = 0
  if longest_stretch >= 2
    contains_an_inverted_repeat = true
  return contains_an_inverted_repeat

.convert_global_env(i) ⇒ Object



Note that the method will pick only the first argument given to it if an Array is supplied.


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 801

def self.convert_global_env(i)
  if i.is_a? Array
    i = i.first
  unless Object.const_defined? :ConvertGlobalEnv
    begin # Require an external gem in this case.
      require 'convert_global_env'
    rescue LoadError; end
  if Object.const_defined? :ConvertGlobalEnv
    if i and !i.start_with?('$')
      i = i.dup if i.frozen?
    return ConvertGlobalEnv.convert(i, :do_not_report_errors) # Handle ENV variables.
  return i

.convert_one_letter_to_full(i) ⇒ Object



Convert one aminoacid to the real name.

Usage example:

Bioroebe.convert_one_letter_to_full('T') # => "threonine"

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 1982

def self.convert_one_letter_to_full(i)
  if i.is_a? Array
    i.each {|entry| convert_one_letter_to_full(entry) }
    i = i.to_s.downcase # need it to be downcased.
    three_letters = convert_one_letter_to_three(i)
    i = AMINO_ACIDS_ABBREVIATIONS[three_letters]
    return i

.convert_one_letter_to_three(i) ⇒ Object



Convert a one-letter-code for an aminoacid into the slightly longer three-letter-code variant for that particular aminoacid.

Note that this method will return the result in a downcased variant, such as “gly” for “glycine”.


A string of three characters, if it is a valid one-letter aminoacid.

Usage example for an aminoacid such as Glycine:

Bioroebe.convert_one_letter_to_three('G') # => "gly"

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 1634

def self.convert_one_letter_to_three(i)

.convert_this_codon_to_that_aminoacid(i = ARGV, &block) ⇒ Object




# File 'lib/bioroebe/codons/convert_this_codon_to_that_aminoacid.rb', line 225

def self.convert_this_codon_to_that_aminoacid(
    i = ARGV,
  ) { :be_quiet }.result?.to_s

.count_amount_of_aminoacids(i) ⇒ Object




# File 'lib/bioroebe/count/count_amount_of_aminoacids.rb', line 344

def self.count_amount_of_aminoacids(i)

.count_amount_of_nucleotides(i) ⇒ Object



This method will always return the result in the form of a single line. The order is: A C G T

This can also be used to solve a problem listed at Rosalind.

Invocation examples:


# File 'lib/bioroebe/count/count_amount_of_nucleotides.rb', line 483

def self.count_amount_of_nucleotides(i)
  _ =, :do_not_run_yet) { :display_short_form }

.count_AT(i = ARGV) ⇒ Object



This method will count how characters in a given String are “A” or “T”, in total. The method will assume that an Array passed to it is meant to be a String.

So, every time this method encounters a “A” or a “T” in that string, we will “add” +1 to the number that will be returned by that method.

Usage example:


# File 'lib/bioroebe/count/count_at.rb', line 25

def self.count_AT(i = ARGV)
  i = i.join(' ').strip if i.is_a? Array

.count_GC(i = ARGV) ⇒ Object



This method will count how characters in a given String are “G” or “C”, in total. The method will assume that an Array passed to it is meant to be a String.

So, every time this method encounters a “G” or a “C” in that string, we will “add” +1 to the number that will be returned by that method.

Specific usage examples:

Bioroebe.count_GC 'ATTATTATGGCCAATATA' # => 4
Bioroebe.count_GC 'ATG' # => 1

# File 'lib/bioroebe/count/count_gc.rb', line 27

def self.count_GC(i = ARGV)
  i = i.join(' ').strip if i.is_a? Array

.count_non_DNA_bases_in_this_sequence(i, array = Bioroebe.return_DNA_nucleotides) ⇒ Object



Usage example:


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 3044

def self.count_non_DNA_bases_in_this_sequence(
    i, array = Bioroebe.return_DNA_nucleotides
  i = i.dup
  array.each {|this_nucleotide|
  return i.size

.create_file(i) ⇒ Object



This method can be used to create a file.


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 1218

def self.create_file(i)
  FileUtils.touch(i) unless File.file?(i)




This method will create a .jar file.

To invoke it from the commandline do:

bioroebe --jar

To execute a .jar file do:

java -jar foobar.jar

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 3154

def self.create_jar_archive
  e 'Creating a .jar archive next:'
  original_dir = return_pwd
  cd '/home/x/programming/ruby/src/bioroebe/lib/bioroebe/java/bioroebe/src/main/java/'
  esystem 'jar cf bioroebe.jar bioroebe/'
  target_file = File.absolute_path('bioroebe.jar')
  cd original_dir
  if File.exist? target_file
    e 'Moving the created .jar file into the current working '\
      'directory next.'
    move_file(target_file, original_dir)
    e 'It should now be at:'
    e sfile("  #{original_dir}#{File.basename(target_file)}")
  #   esystem 'jar cfe bioroebe.jar myClass myClass.class'

.create_new_sequence(i = ARGV, &block) ⇒ Object



Create a new Bioroebe::Sequence object. It will also assign to the @sequence module-level instance variable.


# File 'lib/bioroebe/sequence/sequence.rb', line 727

def self.create_new_sequence(i = ARGV, &block)
  @sequence =, &block)

.create_random_aminoacids(how_many_aminoacids = CREATE_N_AMINOACIDS, split_at = nil, be_verbose = false, &block) ⇒ Object



This method will create a random chain of aminoacids.

The first argument to this method shall denote how many aminoacids are to be generated, e. g. 25 would mean to create “25 aminoacids”.

If the second argument, called ‘split_at`, is not nil and is a number, then this method we add a newline into the returned String.

This method will return a String, consisting of the random aminoacids.

Usage Examples:

Bioroebe.create_random_aminoacids 125
Bioroebe.create_random_aminoacids  25 # => "SQHWVGGGVSRCWLMWAPECMYVWW"
Bioroebe.create_random_aminoacids  15 # => "CLKHMLMGLVAEEKA"
Bioroebe.random_aminoacids(5) # => "STRRM"
Bioroebe.random_aminoacids(8) # => "TRTQHSNN"s

# File 'lib/bioroebe/aminoacids/create_random_aminoacids.rb', line 203

def self.create_random_aminoacids(
    how_many_aminoacids = CREATE_N_AMINOACIDS,
    split_at            = nil,
    be_verbose          = false,
  _ =
  return _.amino_acid_sequence # ← And return the aminoacid sequence here.

.create_the_pdf_tutorial(read_from_this_file = '/home/x/programming/ruby/src/bioroebe/', store_where = '/Depot/j/example.pdf') ⇒ Object



This method can be used to quickly turn the file into a .pdf file, for whatever the reason the user may want this.


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 2881

def self.create_the_pdf_tutorial(
    read_from_this_file = '/home/x/programming/ruby/src/bioroebe/',
    store_where         = '/Depot/j/example.pdf'

  require 'prawn'

  Prawn::Fonts::AFM.hide_m17n_warning = true # Hide a useless warning.

  pdf =
          page_size: 'A4',
          page_layout: :landscape
  pdf.text "The Bioroebe Project", size: 80
  pdf.bounding_box [50, 600], width: 200 do
    pdf.fill_color '000000'
    pdf.text "making bioinformatics great again:", size: 15
  dataset =, encoding: UTF_ENCODING)
  dataset = dataset.encode("Windows-1252", invalid: :replace, undef: :replace)

  e 'Storing at this location: '+store_where
  pdf.render_file store_where

.decode_this_aminoacid_sequence(i = 'KKKA') ⇒ Object



This method can be used as means to decode an aminoacid sequence, such as a String like ‘KKKA’.

The input to this method may also be in the form of an Array, such as [‘K’,‘K’,‘K’,‘A’]. Only valid one-letter aminoacids will be honoured by this method; invalid letters will be silently dropped.

After that, this method will replace all valid letters, that is valid aminoacids (in single letter code), with the corresponding codon. It will return all possibilities.

Invocation example:

Bioroebe.decode_this_aminoacid_sequence('KKKA') # => [["AAG", "AAA"], ["AAG", "AAA"], ["AAG", "AAA"], ["GCT", "GCC", "GCA", "GCG"]]

# File 'lib/bioroebe/codons/codons.rb', line 385

def self.decode_this_aminoacid_sequence(
    i = 'KKKA'
  if i.is_a? Array
    i = i.join
  if i.is_a? String
    # ===================================================================== #
    # We may have a 3-letter code too, so check for that first.
    # ===================================================================== #
    if i.include? '-'
      i = i.split('-').map {|entry| ::Bioroebe.three_to_one(entry) }
      i = i.split(//)
  i = [i] {|entry|
  return i

.deduce_aminoacid_sequence(from_this_sequence = :default) ⇒ Object




# File 'lib/bioroebe/aminoacids/deduce_aminoacid_sequence.rb', line 465

def self.deduce_aminoacid_sequence(
    from_this_sequence = :default

.deduce_most_likely_aminoacid_sequence(from_this_sequence = :default) ⇒ Object




# File 'lib/bioroebe/nucleotides/most_likely_nucleotide_sequence_for_this_aminoacid_sequence.rb', line 140

def self.deduce_most_likely_aminoacid_sequence(from_this_sequence = :default)

.deduce_most_likely_aminoacid_sequence_as_string(i, use_this_codon_tables_frequencies = :default) ⇒ Object



This method will attempt to deduce the most likely aminoacid sequence for a given protein, as a String.

Usage example:

Bioroebe.deduce_most_likely_aminoacid_sequence_as_string('KKKA') # => "AAGAAGAAGGCC"

# File 'lib/bioroebe/codons/codons.rb', line 452

def self.deduce_most_likely_aminoacid_sequence_as_string(
    i, use_this_codon_tables_frequencies = :default
  result = return_the_most_likely_codon_sequence_for_this_aminoacid_sequence(
  result = result.join if result.is_a? Array
  return result






  • (Boolean)

# File 'lib/bioroebe/colours/colours.rb', line 96

def self.default_colour?




This is simply the primary delimiter used for reading “multiline input” of the Bioroebe::Shell component.



  • (Boolean)

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 413

def self.delimiter?




This method can be used to determine N-Glycosylation patterns in a protein.

The input to this method should be an aminoacid chain - aka a protein sequence.

This method will return an Array. This Array holds the indices where a N-glycosylation pattern begins.

Usage example:

Bioroebe.determine_n_glycosylation_matches # => [85, 118, 142, 306, 395]

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 2086

def self.determine_n_glycosylation_matches(
    of_this_protein_sequence =
  if of_this_protein_sequence.is_a? Array
    of_this_protein_sequence.each {|this_sequence|
    scanned = of_this_protein_sequence.scan(
    ) {|substring|
      of_this_protein_sequence.index(substring)+1 # +1 because ruby starts at 0.

.determine_start_codons_from_the_codon_table(this_codon_table_dataset = @codon_table_dataset) ⇒ Object




# File 'lib/bioroebe/codons/codons.rb', line 61

def self.determine_start_codons_from_the_codon_table(
    this_codon_table_dataset = @codon_table_dataset
  this_codon_table_dataset = {|key, value|
    key == 'START' # '*' refers to a stop codon.
  use_these_start_codons = this_codon_table_dataset.values
  if use_these_start_codons.is_a? Array
    use_these_start_codons = use_these_start_codons.first

.determine_stop_codons_from_the_codon_table(this_codon_table_dataset = @codon_table_dataset) ⇒ Object



This method will determine the stop codons in use for the given species/organism, depending on the proper codon table.


# File 'lib/bioroebe/codons/codons.rb', line 45

def self.determine_stop_codons_from_the_codon_table(
    this_codon_table_dataset = @codon_table_dataset
  this_codon_table_dataset = {|key, value|
    value == '*' # '*' refers to a stop codon.
  use_these_stop_codons = this_codon_table_dataset.keys

.digest_this_dna(this_DNA_sequence, hash = {}) ⇒ Object



This method depends on the file bioroebe/fasta_and_fastq/parse_fasta/parse_fasta.rb.

Usage examples:

x = Bioroebe.digest_this_dna(:lambda_genome, with: :EcoRI)
x = Bioroebe.digest_this_dna("/root/Bioroebe/fasta/NC_001416.1_Enterobacteria_phage_lambda_complete_genome.fasta", with: :EcoRI)
x = Bioroebe.digest_this_dna("/Depot/j/foobar.fasta", with: :PvuII)

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 3796

def self.digest_this_dna(
    hash = {}
  require 'bioroebe/fasta_and_fastq/parse_fasta/parse_fasta.rb'
  restriction_enzymes = Bioroebe.load_and_return_the_restriction_enzymes
  this_restriction_enzyme = nil
  nucleotide_sequence = nil
  if this_DNA_sequence.is_a? Array
    this_DNA_sequence = this_DNA_sequence.first
  if this_DNA_sequence.is_a?(String) and File.exist?(this_DNA_sequence)
    nucleotide_sequence =
  # ======================================================================= #
  # === Handle the hash next (and ensure that it is a Hash)
  # ======================================================================= #
  if hash.is_a? Hash
    # ===================================================================== #
    # === :with
    # ===================================================================== #
    if hash.has_key? :with
      this_restriction_enzyme = hash.delete(:with).to_s
  target_sequence = restriction_enzymes[this_restriction_enzyme].dup
  if target_sequence =~ /\d$/ # If it ends with a number.
  if nucleotide_sequence and
    print rev+'Yes, the restriction-sequence '+
          ' is found in the given sequence. '
    scanned = nucleotide_sequence.scan(
    erev "It can be found #{steelblue(scanned.size.to_s)}#{rev} "\
         "times, at these positions:"
    sub_sequences = nucleotide_sequence.split(/#{target_sequence}/)
    sub_sequences.sort_by {|entry| entry.size }.reverse.each {|sequence|
      erev "  #{sequence.size}"
    return sub_sequences
    e 'Nothing found.'

.directory_frequencies?(codon_tables_directory = CODON_TABLES_DIRECTORY) ⇒ Boolean



Preferentially use this method past the year 2022 - it is a tiny bit more flexible than the above constant.



  • (Boolean)

# File 'lib/bioroebe/constants/constants.rb', line 685

def self.directory_frequencies?(
    codon_tables_directory = CODON_TABLES_DIRECTORY

.disable_colours(be_verbose = false) ⇒ Object



Use this method if you wish to disable colours for the whole Bioroebe project.


# File 'lib/bioroebe/colours/colours.rb', line 186

def self.disable_colours(be_verbose = false)
  if be_verbose
    e 'Disabling colours.'
  @use_colours = false

.display_all_open_reading_frames_from_this_sequence(i = ARGV) ⇒ Object




# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 1560

def self.display_all_open_reading_frames_from_this_sequence(i = ARGV)
  require 'bioroebe/colours/colours.rb'
  if i.empty?
    array = Bioroebe.return_all_open_reading_frames_from_this_sequence
    pp array
    pp Bioroebe.to_aa(array)
    this_sequence = i
    array = return_all_open_reading_frames_from_this_sequence(this_sequence)
    this_sequence = this_sequence.join
    if array.empty?
      e "No open reading from has been found from "\
        "this sequence: #{this_sequence}"
      e rev+
        'The following ORFs have been found in this sequence: '
      e "  #{Colours.lightgreen(this_sequence)}"
      array.each_with_index {|sequence, index| index += 1
        name_for_the_ORF = "ORF number #{index}"
        e "  #{Colours.steelblue(sequence.ljust(50))} "\
          "#{Colours.lightslategrey('#')} "\

.dna_sequence(i) ⇒ Object



Usage example:

dna = Bioroebe.dna_sequence('ATTCGGU')

# File 'lib/bioroebe/sequence/dna.rb', line 200

def self.dna_sequence(i)
  i = i.first if i.is_a? Array
  i.delete!('U') # Reject Uracil there.

.dna_to_aminoacid_sequence(i = ARGV) ⇒ Object



Usage example:

Bioroebe.dna_to_aminoacid_sequence('ATGGGGCCC') # => "MGP"

# File 'lib/bioroebe/conversions/dna_to_aminoacid_sequence.rb', line 610

def self.dna_to_aminoacid_sequence(
    i = ARGV
  ) { :be_quiet }.sequence?




Do not truncate any “too long” output. This method disable the truncate-functionality.


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 146

def self.do_not_truncate
  @truncate = false





# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 136

def self.do_truncate
  @truncate = true

.dotplot_array(dna_x, dna_y) ⇒ Object



This method can be used to return a 2D dotplot-array of two input sequences. Be careful with large data as input - the RAM usage may go up, so this method has NOT been optimized for such situations. It is deliberately kept simple.


# File 'lib/bioroebe/dotplots/advanced_dotplot.rb', line 215

def self.dotplot_array(dna_x, dna_y)
  dotplot_matrix =
    dna_y.size,, 0)
  dotplot_matrix = { { 0 }
  dna_x.chars.each_with_index {|x_value, x_index|
    # ===================================================================== #
    # Next, we work from top-to-bottom.
    # ===================================================================== #
    dna_y.chars.each_with_index {|y_value, y_index|
      if x_value == y_value
        dotplot_matrix[y_index][x_index] = 1
  return dotplot_matrix

.downcase_chunked_display(i, group_together_n_nucleotides = 10) ⇒ Object



This is similar to the regular chunked display, but will return the nucleotides in a downcased manner, aka “A” will become “a” and so forth.

In the past this functionality resided in its own .rb file, but since as of March 2020 a bin/ executable was added, so that the functionality can be more easily called when the bioroebe gem is installed.

Usage example:


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 4154

def self.downcase_chunked_display(
    group_together_n_nucleotides = 10
  sequence = ::Bioroebe.return_chunked_display(i, group_together_n_nucleotides).downcase
  return sequence

.download(from_these_URLs) ⇒ Object



# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 4415

  require 'open-uri'
  array_these_urls = [from_these_URLs].flatten.compact
  array_these_urls.each {|remote_url|
    # ===================================================================== #
    # First, we must determine the remote file listing here.
    # Due to convenience we will simply use curl here.
    # ===================================================================== #
    cmd = "curl -s \"#{remote_url}\" --list-only"
    # e cmd
    remote_files = `#{cmd}`.split("\n")
    remote_files.each {|this_remote_file|
      target = remote_url+this_remote_file
      e "Downloading `#{this_remote_file}` next. '"\
        "(Full target: '#{target})"






  • (Boolean)

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 171

def self.download_directory?

.download_fasta(i) ⇒ Object



Easier wrapper-method to download fasta files.


# File 'lib/bioroebe/fasta_and_fastq/download_fasta.rb', line 233

def self.download_fasta(i)

.download_human_genome(from_this_URL = '') ⇒ Object




# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 2781

def self.download_human_genome(
    from_this_URL = ''
  esystem "wget #{from_this_URL}"

.download_taxonomy_database(i = ::Bioroebe::FTP_NCBI_TAXONOMY_DATABASE) ⇒ Object




# File 'lib/bioroebe/databases/download_taxonomy_database.rb', line 92

def self.download_taxonomy_database(

.download_this_pdb(i = '355D') ⇒ Object



This method can be used to download a remote .pdb file to the local file-system. If the default pdb/ directory exists as well locally then the downloaded .pdb file will be relocated into that file.

An example for a remote URL to a .pdb file would be:

# File 'lib/bioroebe/pdb_and_protein_structure/download_this_pdb.rb', line 29

def self.download_this_pdb(
    i = '355D'
  # ======================================================================= #
  # Treat all input as an Array past the next point.
  # ======================================================================= #
  [i].flatten.compact.each {|this_entry|
    if this_entry.frozen?
      this_entry = this_entry.dup
    if this_entry.end_with? '.pdb' # This will lateron be appended again anyway.
    this_entry.upcase! # For convenience.
    unless this_entry.end_with? '.pdb'
      this_entry << '.pdb'
    e this_entry
    # ===================================================================== #
    # Build up our remote URL next:
    # ===================================================================== #
    remote_url = "{this_entry}"
    e steelblue(remote_url)
    esystem "wget #{remote_url}"
    _ = File.basename(remote_url)
    if File.exist? _

.e(i = '') ⇒ Object




# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 246

def self.e(i = '')
  puts i




This method will determine which editor is to be used, if we have to use an editor for the bioroebe project.



  • (Boolean)

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 442

def self.editor?
  require 'bioroebe/configuration/constants.rb'





# File 'lib/bioroebe/www/embeddable_interface.rb', line 775

def self.embeddable_interface
  object =
  return object




Use this method to enable colours for the whole Bioroebe project.

All classes that are part of the Bioroebe project should honour this setting (if it is a class that may make use of colours; some smaller classes do not need colours, and hence have no need for the method here).


# File 'lib/bioroebe/colours/colours.rb', line 203

def self.enable_colours
  @use_colours = true




This method will ensure that the base directory for the Bioroebe project exist.


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 3282

def self.ensure_that_the_base_directories_exist
  # ======================================================================= #
  # We also need to create the temp directory, as well as having to
  # notify the user that this will be done. The taxonomy subdirectory
  # will also be created.
  # ======================================================================= #
  use_this_log_dir = log_dir?
  unless File.exist? use_this_log_dir
    erev "The base directory at `#{sdir(use_this_log_dir)}#{rev}` does not exist."
    erev 'It will thus be created next.'
    mkdir use_this_log_dir
  # ======================================================================= #
  # === Ensure that the Downloads/ directory exists
  # ======================================================================= #
  _ = "#{use_this_log_dir}Downloads/"
  unless File.exist? _
    erev "The directory at `#{sdir(_)}#{rev}` does not exist."
    erev 'It will thus be created next.'
    mkdir _
  # ======================================================================= #
  # === Ensure that the pdb/ directory exists
  # ======================================================================= #
  _ = "#{use_this_log_dir}pdb/"
  unless File.exist? _
    erev "The directory at `#{sdir(_)}#{rev}` does not exist."
    erev 'It will thus be created next.'
    mkdir _
  autogenerated_sql_files_dir =
  unless Dir.exist? autogenerated_sql_files_dir
    erev 'The directory at `'+sdir(autogenerated_sql_files_dir)+
         rev+'` does not exist.'
    erev 'It will thus be created next.'

.erev(i = '') ⇒ Object




# File 'lib/bioroebe/colours/colours.rb', line 69

def self.erev(i = '')
  puts "#{rev}#{i}"

.esystem(i) ⇒ Object




# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 253

def self.esystem(i)
  puts i.to_s
  system i.to_s

.every_reverse_palindrome_in_this_string(i = 'TCAATGCATGCGGGTCTATATGCAT', min_length = 4, max_length = 12) ⇒ Object



This method can return every reverse palindrome in the given input String.

The output will be an Array such as this:

[[4, 6], [5, 4], [6, 6], [7, 4], [17, 4], [18, 4], [4, 6], [5, 4]]

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 4971

def self.every_reverse_palindrome_in_this_string(
    min_length =  4,
    max_length = 12
  require 'bioroebe/sequence/reverse_complement.rb'
  if i.is_a? Array # Arrays will become Strings - or rather, whatever is the first argument.
    i = i.first
  if i and File.exist?(i)
    i = File.readlines(i).reject {|entry|
    }.map {|inner_entry| inner_entry.strip }.join
  # ======================================================================= #
  # How do we find all subsequences that are relevant? Well - we
  # need to find all the sequences between min_length and
  # max_length, e. g. 4 and 12.
  # ======================================================================= #
  string = i.dup
  array_containing_starting_index_and_length_of_reverse_palindromes = []
  i.size.times {
    substrings = return_every_substring_from_this_sequence(string)
    substrings.each {|entry|
      next if entry.size > max_length
      if (entry.size >= min_length) and
         (Bioroebe.reverse_complement(entry) == entry)
        array_containing_starting_index_and_length_of_reverse_palindromes << 
          [i.index(entry)+1, entry.size]
    string[0,1] = ''
  return array_containing_starting_index_and_length_of_reverse_palindromes

.ewarn(i = '') ⇒ Object




# File 'lib/bioroebe/colours/colours.rb', line 168

def self.ewarn(i = '')
  e swarn(i)

.extract(i = ARGV) ⇒ Object



This method can be used to quickly extract a local archive.


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 2321

def self.extract(
    i = ARGV
  require 'bioroebe/colours/sdir_sfancy_sfile_simp_swarn.rb'
  if i.is_a? Array
    i = i.join(' ').strip
  unless i.include?('/')
    unless File.exist? i
      i = return_pwd+
  if File.exist? i
    case i
    when /bz2$/
      _ = "tar -xfv #{i}"
    when /xz$/
      _ = "tar -xvf #{i}"
    if be_verbose?
      e "Now extracting `#{sfancy((i).squeeze('/'))}`."
      e 'Done extracting!'
      system _
    ewarn "Can not extract #{sfile(i)} because it does "\
          "not appear to exist."

.extractseq(i = 'AAAGGGTTT', *regions) ⇒ Object



Bioroebe.extractseq reads a sequence and writes sub-sequences from it to file. The set of regions to extract is specified on the command-line or in a file as pairs of start and end positions. The regions are written in the order in which they are specified. Thus, if the sequence AAAGGGTTT has been input and the regions: 7-9, 3-4 have been specified, then the output sequence will be:


See the next ruler for that:

012345678 # real index
123456789 # desired index

Usage example

Bioroebe.extractseq('AAAGGGTTT', '7-9','3-4') # => TTTAG

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 282

def self.extractseq(
    i = 'AAAGGGTTT',
  new_sequence = ''.dup
  regions.each {|this_region|
    splitted = this_region.split('-') # We assume a '-' must be there.
    first_position = splitted[0].to_i - 1
    last_position  = splitted[1].to_i - 1
    subsequence = i[first_position .. last_position]
    new_sequence << subsequence
  return new_sequence






  • (Boolean)

# File 'lib/bioroebe/constants/constants.rb', line 721

def self.fasta_dir?




This method will return a path such as “/root/Bioroebe/fasta/”.



  • (Boolean)

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 193

def self.fasta_directory?

.fetch_data_from_uniprot(i = ARGV) ⇒ Object




# File 'lib/bioroebe/utility_scripts/fetch_data_from_uniprot/fetch_data_from_uniprot.rb', line 259

def self.fetch_data_from_uniprot(i = ARGV)

.fetch_fasta_sequence_from_pdb(i = ARGV) ⇒ Object




# File 'lib/bioroebe/pdb_and_protein_structure/fetch_fasta_sequence_from_pdb.rb', line 126

def self.fetch_fasta_sequence_from_pdb(i = ARGV)





# File 'lib/bioroebe/constants/constants.rb', line 638

def self.file_amino_acids





# File 'lib/bioroebe/constants/constants.rb', line 651

def self.file_amino_acids_abbreviations





# File 'lib/bioroebe/constants/constants.rb', line 830

def self.file_amino_acids_frequency




This method will return a String such as:


# File 'lib/bioroebe/constants/constants.rb', line 1134

def self.file_amino_acids_long_name_to_one_letter




This constant will point to a location such as this one here:


# File 'lib/bioroebe/constants/constants.rb', line 733

def self.file_fastq_quality_schemes





# File 'lib/bioroebe/constants/constants.rb', line 1122

def self.file_molecular_weight





# File 'lib/bioroebe/constants/constants.rb', line 885

def self.file_restriction_enzymes




This file can normally be found here:



  • (Boolean)

# File 'lib/bioroebe/constants/constants.rb', line 714

def self.file_statistics?





# File 'lib/bioroebe/constants/constants.rb', line 740

def self.file_talens

.filter_away_invalid_aminoacids(i) ⇒ Object



Usage example:

Bioroebe.filter_away_invalid_aminoacids('ATMÜ') # => "ATM"

# File 'lib/bioroebe/constants/constants.rb', line 174

def self.filter_away_invalid_aminoacids(i)
  array_that_is_allowed = all_aminoacids?
  return {|entry| array_that_is_allowed.include? entry }.join

.filter_away_invalid_nucleotides(i, preserve_uracil = false) ⇒ Object



This method can be used to filter away invalid nucleotides. An “invalid” nucleotide is, for example, if you work with DNA sequences, any character that is not allowed to be part of DNA. For example, Uracil, which can be found (almost exclusively) only in RNA.

As for now, the behaviour is to downcase the given input before applying the .tr() method on the given String.

Usage example:

Bioroebe.filter_away_invalid_nucleotides 'ATGCCGGAGGAGANNN' # => "ATGCCGGAGGAGA"

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 3865

def self.filter_away_invalid_nucleotides(
    preserve_uracil = false
  if i.is_a? Array
    i = i.join(' ').strip
  case preserve_uracil
  when :preserve_uracil
    preserve_uracil = true
  when :preserve_nothing
    preserve_uracil = false
  i = i.to_s.upcase
  if preserve_uracil!('B,D-F,H-S,V-Z','') # A T C G U
  else!('B,D-F,H-S,U-Z','') # A T C G
  return i

.find_substring(full_string = 'GATATATGCATATACTT', this_substring = :default) ⇒ Object



This method can be used to find a substring within a larger String.

For example, in the below default values, the substring “ATAT” would exist at the positions 2, 4 and 10, if compared to the larger parent string “GATATATGCATATACTT”.

The following display may help you see this more easily, in regards to the substring matches:


If you look closely, you will be able to see that “ATAT” can be found three times in the string above.

Indices in this context start at position 1, not 0. This is mostly done to refer to nucleotides or aminoacids, which also typically start at the first letter. Position 0 makes no sense for a nucleotide - what would “nucleotide 0” even refer to?

The first argument to this method may also be the path to a locally existing file, such as “/rosalind_subs.txt”. In fact this method has been largely motivated by Rosalind tasks.

The method will return an Array with the positions of all substrings that are found in the full_string variable. See the usage example below for how this may be.

Usage example:

Bioroebe.find_substring 'GATATATGCATATACTT', 'ATAT' # => [2, 4, 10]

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 2424

def self.find_substring(
    full_string    = 'GATATATGCATATACTT', # ← The full String comes here.
    this_substring = :default             # ← The substring we are searching for comes here.
  if full_string.is_a? Array
    # ===================================================================== #
    # Presently this method will only work on the first member of an Array.
    # ===================================================================== #
    full_string = full_string.first
  if full_string and File.file?(full_string) and
     this_substring == :default
    # ===================================================================== #
    # In this case it is ok to read from that file.
    # ===================================================================== #
    _ =
    splitted = _.split("\n")
    full_string    = splitted.first
    this_substring = splitted.last
  case this_substring
  # ======================================================================= #
  # Use a default value in this case. In reality users should supply
  # their own substring when they use this method here.
  # ======================================================================= #
  when :default,
    this_substring = 'ATAT'
    if this_substring.empty?
      this_substring = 'ATAT'
  if full_string.nil? or full_string.empty?
    full_string = 'GATATATGCATATACTT' # ← Use the default in this case.
  result = { |indexes|
    final_index_position = full_string.size - this_substring.size
    i = 0
    while (i < final_index_position)
      index = full_string.to_s.index(this_substring.to_s, i)
      break if index.nil?
      i = index + 1
      indexes << i
  result = nil if result.empty? # ← We will try this here; could also return an empty Array, though.
  result # Return our findings here.

.format_this_nucleotide_sequence(i = ARGV, &block) ⇒ Object




# File 'lib/bioroebe/nucleotides/show_nucleotide_sequence/show_nucleotide_sequence.rb', line 660

def self.format_this_nucleotide_sequence(
    i = ARGV,
  _ =
    i, :do_not_report_anything, &block

.frequency_per_thousand(i) ⇒ Object



The input to this method should be a String ideally. If an Array is input then it will simply be .join()-ed.

This method will return a String, if all goes well.


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 867

def self.frequency_per_thousand(i)
  result = "fields: [triplet] [frequency: per thousand] ([number])\n".dup # This String will be returned.
  if i.is_a? Array
    i = i.join
  hash = ::Bioroebe.codon_frequency_of_this_string(i)
  hash.default = 0
  total_n_elements = hash.values.sum
  append_this = <<-EOF 

UUU#{thousand_percentage(hash['UUU'], total_n_elements)}(     #{hash['UUU']})  UCU#{thousand_percentage(hash['UCU'], total_n_elements)}(     #{hash['UCU']})  UAU#{thousand_percentage(hash['UAU'], total_n_elements)}(     #{hash['UAU']})  UGU#{thousand_percentage(hash['UGU'], total_n_elements)}(     #{hash['UGU']})
UUC#{thousand_percentage(hash['UUC'], total_n_elements)}(     #{hash['UUC']})  UCC#{thousand_percentage(hash['UCC'], total_n_elements)}(     #{hash['UCC']})  UAC#{thousand_percentage(hash['UAC'], total_n_elements)}(     #{hash['UAC']})  UGC#{thousand_percentage(hash['UGC'], total_n_elements)}(     #{hash['UGC']})
UUA#{thousand_percentage(hash['UUA'], total_n_elements)}(     #{hash['UUA']})  UCA#{thousand_percentage(hash['UCA'], total_n_elements)}(     #{hash['UCA']})  UAA#{thousand_percentage(hash['UAA'], total_n_elements)}(     #{hash['UAA']})  UGA#{thousand_percentage(hash['UGA'], total_n_elements)}(     #{hash['UGA']})
UUG#{thousand_percentage(hash['UUG'], total_n_elements)}(     #{hash['UUG']})  UCG#{thousand_percentage(hash['UCG'], total_n_elements)}(     #{hash['UCG']})  UAG#{thousand_percentage(hash['UAG'], total_n_elements)}(     #{hash['UAG']})  UGG#{thousand_percentage(hash['UGG'], total_n_elements)}(     #{hash['UGG']})

CUU#{thousand_percentage(hash['CUU'], total_n_elements)}(     #{hash['CUU']})  CCU#{thousand_percentage(hash['CCU'], total_n_elements)}(     #{hash['CCU']})  CAU#{thousand_percentage(hash['CAU'], total_n_elements)}(     #{hash['CAU']})  CGU#{thousand_percentage(hash['CGU'], total_n_elements)}(     #{hash['CGU']})
CUC#{thousand_percentage(hash['CUC'], total_n_elements)}(     #{hash['CUC']})  CCC#{thousand_percentage(hash['CCC'], total_n_elements)}(     #{hash['CCC']})  CAC#{thousand_percentage(hash['CAC'], total_n_elements)}(     #{hash['CAC']})  CGC#{thousand_percentage(hash['CGC'], total_n_elements)}(     #{hash['CGC']})
CUA#{thousand_percentage(hash['CUA'], total_n_elements)}(     #{hash['CUA']})  CCA#{thousand_percentage(hash['CCA'], total_n_elements)}(     #{hash['CCA']})  CAA#{thousand_percentage(hash['CAA'], total_n_elements)}(     #{hash['CAA']})  CGA#{thousand_percentage(hash['CGA'], total_n_elements)}(     #{hash['CGA']})
CUG#{thousand_percentage(hash['CUG'], total_n_elements)}(     #{hash['CUG']})  CCG#{thousand_percentage(hash['CCG'], total_n_elements)}(     #{hash['CCG']})  CAG#{thousand_percentage(hash['CAG'], total_n_elements)}(     #{hash['CAG']})  CGG#{thousand_percentage(hash['CGG'], total_n_elements)}(     #{hash['CGG']})

AUU#{thousand_percentage(hash['AUU'], total_n_elements)}(     #{hash['AUU']})  ACU#{thousand_percentage(hash['ACU'], total_n_elements)}(     #{hash['ACU']})  AAU#{thousand_percentage(hash['AAU'], total_n_elements)}(     #{hash['AAU']})  AGU#{thousand_percentage(hash['AGU'], total_n_elements)}(     #{hash['AGU']})
AUC#{thousand_percentage(hash['AUC'], total_n_elements)}(     #{hash['AUC']})  ACC#{thousand_percentage(hash['ACC'], total_n_elements)}(     #{hash['ACC']})  AAC#{thousand_percentage(hash['AAC'], total_n_elements)}(     #{hash['AAC']})  AGC#{thousand_percentage(hash['AGC'], total_n_elements)}(     #{hash['AGC']})
AUA#{thousand_percentage(hash['AUA'], total_n_elements)}(     #{hash['AUA']})  ACA#{thousand_percentage(hash['ACA'], total_n_elements)}(     #{hash['ACA']})  AAA#{thousand_percentage(hash['AAA'], total_n_elements)}(     #{hash['AAA']})  AGA#{thousand_percentage(hash['AGA'], total_n_elements)}(     #{hash['AGA']})
AUG#{thousand_percentage(hash['AUG'], total_n_elements)}(     #{hash['AUG']})  ACG#{thousand_percentage(hash['ACG'], total_n_elements)}(     #{hash['ACG']})  AAG#{thousand_percentage(hash['AAG'], total_n_elements)}(     #{hash['AAG']})  AGG#{thousand_percentage(hash['AGG'], total_n_elements)}(     #{hash['AGG']})

GUU#{thousand_percentage(hash['GUU'], total_n_elements)}(     #{hash['GUU']})  GCU#{thousand_percentage(hash['GCU'], total_n_elements)}(     #{hash['GCU']})  GAU#{thousand_percentage(hash['GAU'], total_n_elements)}(     #{hash['GAU']})  GGU#{thousand_percentage(hash['GGU'], total_n_elements)}(     #{hash['GGU']})
GUC#{thousand_percentage(hash['GUC'], total_n_elements)}(     #{hash['GUC']})  GCC#{thousand_percentage(hash['GCC'], total_n_elements)}(     #{hash['GCC']})  GAC#{thousand_percentage(hash['GAC'], total_n_elements)}(     #{hash['GAC']})  GGC#{thousand_percentage(hash['GGC'], total_n_elements)}(     #{hash['GGC']})
GUA#{thousand_percentage(hash['GUA'], total_n_elements)}(     #{hash['GUA']})  GCA#{thousand_percentage(hash['GCA'], total_n_elements)}(     #{hash['GCA']})  GAA#{thousand_percentage(hash['GAA'], total_n_elements)}(     #{hash['GAA']})  GGA#{thousand_percentage(hash['GGA'], total_n_elements)}(     #{hash['GGA']})
GUG#{thousand_percentage(hash['GUG'], total_n_elements)}(     #{hash['GUG']})  GCG#{thousand_percentage(hash['GCG'], total_n_elements)}(     #{hash['GCG']})  GAG#{thousand_percentage(hash['GAG'], total_n_elements)}(     #{hash['GAG']})  GGG#{thousand_percentage(hash['GGG'], total_n_elements)}(     #{hash['GGG']})
  result << append_this
  return result

.gc_content(of_this_sequence, round_to_n_positions = 3) ⇒ Object



This is a convenience method that will return back the GC content, as a percentage value, of the input-given sequence (nucleotide sequence).

So for instance, the following example will correctly return 50.0 because the G and C content of the sequence is exactly 50%.

The second argument can be used for denoting where to round.

Usage example:

Bioroebe.gc_content('ATCG') # => 50.0

# File 'lib/bioroebe/calculate/calculate_gc_content.rb', line 280

def self.gc_content(
    round_to_n_positions = 3
  if of_this_sequence.is_a? Array
    of_this_sequence.each {|entry|
      gc_content(of_this_sequence, round_to_n_positions)
      of_this_sequence, round_to_n_positions

.genbank_to_fasta(this_file, be_verbose = :be_verbose) ⇒ Object



This method will convert from a genbank file, to a .fasta file.

Invocation example:


# File 'lib/bioroebe/fasta_and_fastq/parse_fasta/parse_fasta.rb', line 1457

def self.genbank_to_fasta(
    be_verbose = :be_verbose
  case be_verbose
  when :be_quiet
    be_verbose = false
  if this_file.is_a? Array
    this_file = this_file.first
  if File.exist? this_file
    _ = { :be_quiet }
    _ = { :be_quiet }
    _.set_data # This will use the default file.
  file_path = _.save_into_a_fasta_file(be_verbose)
  return file_path

.generate_nucleotide_sequence_based_on_these_frequencies(n_nucleotides = 1061, hash_frequencies = { A: 0.3191430, C: 0.2086633, G: 0.2580345, T: 0.2141593 }) ⇒ Object



The second argument to this method should be a Hash.

The default output may be a String such as this one here:


Usage example:

Bioroebe.generate_nucleotide_sequence_based_on_these_frequencies(:default, { A: 0.25, C: 0.25, G: 0.25, T: 0.25 })

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 4662

def self.generate_nucleotide_sequence_based_on_these_frequencies(
    n_nucleotides = 1061, # Denote how many nucleotides to use.
    hash_frequencies = {
      A: 0.3191430,
      C: 0.2086633,
      G: 0.2580345,
      T: 0.2141593
  case n_nucleotides
  # ======================================================================= #
  # === :default
  # ======================================================================= #
  when :default
    n_nucleotides = 500
  result = ''.dup
  frequency_for_A = hash_frequencies[:A]
  frequency_for_C = hash_frequencies[:C]
  frequency_for_G = hash_frequencies[:G]
  frequency_for_T = hash_frequencies[:T]
  n_nucleotides.times {|run_number_n|
    use_this_number = rand(0)
    if use_this_number <= frequency_for_A
      result << 'A'
    elsif use_this_number <= (frequency_for_A+frequency_for_C)
      result << 'C'
    elsif use_this_number <= (frequency_for_A+frequency_for_C+frequency_for_G)
      result << 'G'
    elsif use_this_number <= (frequency_for_A+frequency_for_C+frequency_for_G+frequency_for_T)
      result << 'T'
  return result





# File 'lib/bioroebe/shell/shell.rb', line 11918

def self.generate_pdf_tutorial

.generate_random_dna_sequence(i = ARGV, optional_hash_with_the_frequencies = {}) ⇒ Object



This method will “generate” a random DNA sequence (as a String).

A String will be returned by this method.

The second argument to this method can be a Hash, specifying the percentage likelihood for each of the nucleotides. See the following usage examples to find out how to use this.

Usage examples:

Bioroebe.random_dna 15 # => "TTGGTAAGCTCTTTA"
Bioroebe.random_dna 25 # => "TTAGCACAAGCATGGACGGACCAGA"
Bioroebe.random_dna(50, { A: 10, T: 10, C: 10, G: 70}) # => "GGGGTGGGGAGGGTATGCGGAGGAAGGGCGGGAAGGGCGGGGGCTGGGCG"
Bioroebe.random_dna(20, 'ATGGGGGGGG') # => "TGAGGGGGGGGGTGGGAGGG"
Bioroebe.random_dna(20, 'ATGGGGGGGG') # => "GGTAGGGGGGGGTAGGGGGG"

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 3669

def self.generate_random_dna_sequence(
    i                                  = ARGV,
    optional_hash_with_the_frequencies = {} # ← This may be a String too, mind you.
  # ======================================================================= #
  # First define our result-String. This one will be returned by this
  # method.
  # ======================================================================= #
  result = ''.dup
  _ = Bioroebe::DNA_NUCLEOTIDES # Get a handle to the four DNA nucleotides.
  if i.is_a? Array
    i = i.join.strip
  case i
  when :default
    i = 250
  i = i.to_i # This is "n times".
  # ======================================================================= #
  # First handle the case where the user passed a String:
  # ======================================================================= #
  if optional_hash_with_the_frequencies.is_a? String
    pool = optional_hash_with_the_frequencies.dup.chars.shuffle
    i.times {
      if pool.size == 0
        pool = optional_hash_with_the_frequencies.dup.chars.shuffle
      result << pool.pop
  elsif optional_hash_with_the_frequencies.empty?
    # ===================================================================== #
    # This is the default clause.
    # ===================================================================== #
    i.times {
      result << _.sample
    # ===================================================================== #
    # Else, the user wants to use a frequency hash:
    # ===================================================================== #
    hash = optional_hash_with_the_frequencies
    frequency_for_A = hash[:A]
    frequency_for_T = hash[:T]
    frequency_for_C = hash[:C]
    frequency_for_G = hash[:G]
    i.times {
      percentage = rand(100)+1
      if percentage <= frequency_for_A
        match = 'A'
      elsif (percentage > frequency_for_A) and
            (percentage <= frequency_for_A+frequency_for_T)
        match = 'T'
      elsif (percentage > frequency_for_A+frequency_for_T) and
            (percentage <= frequency_for_A+frequency_for_T+frequency_for_C)
        match = 'C'
      elsif (percentage > frequency_for_A+frequency_for_T+frequency_for_C) and
            (percentage <= frequency_for_A+frequency_for_T+frequency_for_C+frequency_for_G)
        match = 'G'
        e 'Not found a match for '+percentage.to_s
      result << match

.generate_random_rna_sequence(i = ARGV) ⇒ Object



The input-argument should be a number, an Integer, such as 10.

Usage example:


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 2685

def self.generate_random_rna_sequence(i = ARGV)
  if i.is_a? Array
    i = i.join(' ').strip
  _ = Bioroebe::RNA_NUCLEOTIDES # Point to the allowed RNA-nucleotides here.
  result = ''.dup
  i.to_s.to_i.times {
    result << _.sample
  return result

.guess_format(i) ⇒ Object




# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 2793

def self.guess_format(i)
  case i
  # ======================================================================= #
  # === fasta
  # ======================================================================= #
  when /.fa$/,
  # ======================================================================= #
  # === fastq
  # ======================================================================= #
  when /.fq$/,
  when /.fx/

.hamming_distance(sequence1 = 'ATCG', sequence2 = 'ATCC') ⇒ Object



This method will return an Integer, aka a number, which represents the hamming distance between two sequences of equal length. This will state how many differences exist between two same-sized sequences (aka sequences that have the same length).

Do note that a second implementation may exist for the hamming distance, in the Bioroebe project.

Usage example:

Bioroebe.hamming_distance('ATCG','ATCC') # => 1

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 1062

def self.hamming_distance(
    sequence1 = 'ATCG',
    sequence2 = 'ATCC'
  if sequence1.nil?
    e 'Please provide a sequence (String) as input to this method.'
  if sequence1.is_a? String
    sequence1 = sequence1.split(//)
  if sequence2.is_a? String
    sequence2 = sequence2.split(//)
  array_sequence1 = [sequence1].flatten
  array_sequence2 = [sequence2].flatten
  # ======================================================================= #
  # Zip the two sequences together, then reduce this Array of
  # zipped values to an integer value, which will be returned.
  # ======================================================================= #
  zipped_array =
  hamming_value = 0
  zipped_array.each { |left, right|
    hamming_value += 1 unless left == right
  return hamming_value

.has_this_restriction_enzyme?(name_of_restriction_enzyme) ⇒ Boolean



This method will determine whether we have a specific restriction enzyme registered in the yaml file restriction_enzymes.yml or whether we do not. That way we can query whether a restriction enzyme is registered (and thus available) or whether it is not.

The method will downcase all keys in use to simplify finding a matching entry.

Usage example:

Bioroebe.has_this_restriction_enzyme? 'MvnI'    # => true
Bioroebe.has_this_restriction_enzyme? 'EcoRI'   # => true
Bioroebe.has_this_restriction_enzyme? 'EcoRII'  # => true
Bioroebe.has_this_restriction_enzyme? 'EcoRIII' # => false
Bioroebe.has_this_restriction_enzyme? 'PvuI'    # => true
Bioroebe.has_this_restriction_enzyme? 'PvuII'   # => true
Bioroebe.has_this_restriction_enzyme? 'PvuIII'  # => false


  • (Boolean)

# File 'lib/bioroebe/enzymes/has_this_restriction_enzyme.rb', line 33

def self.has_this_restriction_enzyme?(
  _ = {}
  if name_of_restriction_enzyme.frozen?
    name_of_restriction_enzyme = name_of_restriction_enzyme.dup
  name_of_restriction_enzyme.delete!('?') if name_of_restriction_enzyme.include? '?'
  ::Bioroebe.restriction_enzymes?.each_pair {|key, value|
    _[key.downcase] = value
  return _.has_key? name_of_restriction_enzyme






  • (Boolean)

# File 'lib/bioroebe/codons/codon_tables.rb', line 115

def self.hash_codon_tables?

.index_this_fasta_file(i = ARGV) ⇒ Object



This method will use samtools faidx to index files.


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 569

def self.index_this_fasta_file(i = ARGV)
  [i].flatten.compact.each {|this_file|
    esystem "samtools faidx #{this_file}"

.infer_type_from_this_sequence(i = 'ATGGTACGACAC') ⇒ Object



This method will try to infer the type from a given sequence.

The three valid return types are the following symbols:


Note that this may not work 100% reliably, so do not depend too much on this method working absolutely perfect.


# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 4460

def self.infer_type_from_this_sequence(
  if i.is_a? Array
    i = i.join
  type = :dna # This is the default - DNA.
  # ======================================================================= #
  # === :rna
  # ======================================================================= #
  if i.include? 'U'
    type = :rna
  # ======================================================================= #
  # === :dna
  # ======================================================================= #
  elsif i =~ /^[ATCG]+$/
    type = :dna 
  # ======================================================================= #
  # === :protein
  # ======================================================================= #
  else # else simply assume this to be a protein.
    type = :protein
  return type




This method will first initialize the stop-codons, and then determine the start codons in use.


# File 'lib/bioroebe/codons/codons.rb', line 82

def self.initialize_codons




This method will initialize the default stop codons. This defaults to

    1. the stop codons that can be found in the human genome.

Note that this method will NOT work if @stop_codons already contains elements; this is a tiny “safeguard” to prevent erroneous use. If you wish to not be handicapped then clear it by yourself first, via:


# File 'lib/bioroebe/codons/codons.rb', line 246

def self.initialize_default_stop_codons
  if @stop_codons.empty?
    @stop_codons << %w( TAG TAA TGA ) # <- Add the default stop codons here.

.input_as_dna(i) ⇒ Object



This method will only accept input that is DNA, that is, the short letter variant (thus, A, T, C or G). Any other input will be stripped away, aka discarded, so this methods acts as a filter - a forward-filter for DNA.

The method will return a “String” that is assumed to be a “DNA string”. You can expect only DNA nucleotides to be part of that string.

Usage example:

Bioroebe.input_as_dna 'UUTGAGGACCA' # => "TGAGGACCA"

# File 'lib/bioroebe/toplevel_methods/toplevel_methods.rb', line 4503

def self.input_as_dna(i)
  i = <