Class: Bioroebe::FindGene
- Inherits:
-
CommandlineApplication
- Object
- Base
- CommandlineApplication
- Bioroebe::FindGene
- Defined in:
- lib/bioroebe/utility_scripts/find_gene.rb
Overview
Bioroebe::FindGene
Constant Summary collapse
- DEFAULT_STRING =
#
DEFAULT_STRING
#
'AUGGGAUAUUGUGUGUAUGGGAGGAGAGAUGAAUAGUAGUUAGUUUAUAGAAA'
Constants inherited from CommandlineApplication
CommandlineApplication::OLD_VERBOSE_VALUE
Constants included from ColoursForBase
ColoursForBase::ARRAY_HTML_COLOURS_IN_USE
Constants inherited from Base
Class Method Summary collapse
-
.[](i = ARGV) ⇒ Object
# === Bioroebe::FindGene[] ========================================================================= #.
Instance Method Summary collapse
-
#check_whether_we_have_dna_as_input ⇒ Object
# === check_whether_we_have_dna_as_input ========================================================================= #.
-
#did_not_find_any_gene ⇒ Object
# === did_not_find_any_gene ========================================================================= #.
-
#initialize(i = nil, run_already = true) ⇒ FindGene
constructor
# === initialize ========================================================================= #.
-
#input? ⇒ Boolean
# === input? ========================================================================= #.
-
#process_string ⇒ Object
# === process_string ========================================================================= #.
-
#report_gene ⇒ Object
# === report_gene.
-
#reset ⇒ Object
# === reset ========================================================================= #.
-
#run ⇒ Object
# === run (run tag) ========================================================================= #.
-
#set_input(i = '') ⇒ Object
# === set_input ========================================================================= #.
-
#start_codon? ⇒ Boolean
(also: #start_codons?)
# === start_codon?.
-
#start_stop? ⇒ Boolean
# === start_stop?.
-
#stop_codon? ⇒ Boolean
# === stop_codon?.
-
#stop_codons? ⇒ Boolean
# === stop_codons?.
Methods inherited from CommandlineApplication
#all_aminoacids?, #append_what_into, #at_home?, #be_silent, #be_verbose?, #cat, #ccliner, #change_directory, #cliner, #codon_table_dataset?, #codon_to_aminoacid, #codons_for?, #colourize_this_dna_sequence, #complement, #cp, #disable_warnings, #download_dir?, #editor?, #enable_warnings, #ensure_that_the_base_directories_exist, #esystem, #extract, #is_this_a_start_codon?, #is_this_a_stop_codon?, #leading_five_prime, #load_bioroebe_yaml_file, #log_directory?, #one_letter_to_long_name, #one_to_three, #only_numbers?, #open_in_browser, #opnerev, #opnn, #pad_with_double_quotes, #pad_with_single_quotes, #partner_nucleotide, #remove_numbers, #remove_trailing_ansii_escape_code, #return_all_possible_start_codons, #return_array_of_one_letter_aminoacids, #return_cheerful_person, #return_chunked_display, #return_ubiquitin_sequence, #runmode?, #set_be_verbose, #set_runmode, #strict_filter_away_invalid_aminoacids, #taxonomy_download_directory?, #three_to_one, #to_rna, #trailing_three_prime, #use_opn?, #verbose_truth, #was_or_were, #without_extname, #write_what_into
Methods included from BaseModule
#absolute_path, #default_file_read, #file_readlines
Methods included from CommandlineArguments
#commandline_arguments?, #commandline_arguments_that_are_files?, #e, #first?, #first_non_hyphen_argument?, #remove_hyphens_from_the_commandline_arguments, #return_commandline_arguments_as_string, #return_commandline_arguments_that_are_not_files, #return_entries_without_two_leading_hyphens, #select_commandline_arguments, #select_entries_starting_with_two_hyphens, #set_commandline_arguments
Methods included from ColoursForBase
#colourize_this_aminoacid_sequence_for_the_commandline, #colourize_this_nucleotide_sequence, #disable_colours, #ecomment, #efancy, #egold, #enable_colours, #eorange, #eparse, #erev, #red, #remove_trailing_escape_part, #return_colour_for_nucleotides, #rev, #sdir, #set_will_we_use_colours, #sfancy, #sfile, #simp, #swarn, #use_colours?, #use_colours_within_the_bioroebe_namespace?
Methods inherited from Base
#append_what_into, #can_base_pair?, #convert_global_env, #delete_file, #directory_to_the_codon_tables?, #is_on_roebe?, #is_palindrome?, #main_encoding?, #mkdir, #move_file, #mv, #no_file_exists_at, #no_newlines, #project_yaml_directory?, #rds, #register_sigint, #return_pwd, #return_the_first_line_of_this_file, #word_wrap, #write_what_into
Methods included from InternalHashModule
#internal_hash?, #reset_the_internal_hash
Methods included from InferTheNamespaceModule
#infer_the_namespace, #namespace?
Constructor Details
#initialize(i = nil, run_already = true) ⇒ FindGene
#
initialize
#
36 37 38 39 40 41 42 43 |
# File 'lib/bioroebe/utility_scripts/find_gene.rb', line 36 def initialize( i = nil, run_already = true ) reset set_input(i) run if run_already end |
Class Method Details
.[](i = ARGV) ⇒ Object
#
Bioroebe::FindGene[]
#
196 197 198 |
# File 'lib/bioroebe/utility_scripts/find_gene.rb', line 196 def self.[](i = ARGV) new(i) end |
Instance Method Details
#check_whether_we_have_dna_as_input ⇒ Object
#
check_whether_we_have_dna_as_input
#
177 178 179 180 181 182 |
# File 'lib/bioroebe/utility_scripts/find_gene.rb', line 177 def check_whether_we_have_dna_as_input if @input.include? 'U' @input = @input.dup if @input.frozen? @input.tr!('U','T') end end |
#did_not_find_any_gene ⇒ Object
#
did_not_find_any_gene
#
140 141 142 143 144 145 146 147 148 149 |
# File 'lib/bioroebe/utility_scripts/find_gene.rb', line 140 def did_not_find_any_gene erev 'We did not find any gene in the input sequence `'+ sfancy(@input)+ rev+'`.' erev 'We did use the following elements:' e erev " Start codon: #{simp(start_codon?)}" erev ' Stop codon: '+simp(stop_codons?.join(',')) e end |
#input? ⇒ Boolean
#
input?
#
89 90 91 |
# File 'lib/bioroebe/utility_scripts/find_gene.rb', line 89 def input? @input end |
#process_string ⇒ Object
#
process_string
#
96 97 98 99 100 101 102 103 104 105 106 107 108 |
# File 'lib/bioroebe/utility_scripts/find_gene.rb', line 96 def process_string 0.step(@input.size, 3) { |current_position| _ = @input[current_position, 3] if _ == start_codon? # Match to the given start-codon. # e 'We found a Start Codon.' @start_codon_positions << current_position end if stop_codons?.include? _ # e 'We found a Stop Codon.' @stop_codon_positions << current_position end } end |
#report_gene ⇒ Object
#
report_gene
We try to report whether we have found a gene.
#
156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 |
# File 'lib/bioroebe/utility_scripts/find_gene.rb', line 156 def report_gene unless @start_codon_positions.empty? unless @stop_codon_positions.empty? start = @start_codon_positions[0] end_position = @stop_codon_positions[0] erev 'Found `'+simp(@input[start, end_position])+rev+'` in '\ 'the string' erev sfancy(input?)+rev+',' erev 'which should include the '\ 'start codon ('+start_codon?.to_s+rev+').' else did_not_find_any_gene end else did_not_find_any_gene end end |
#reset ⇒ Object
#
reset
#
48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 |
# File 'lib/bioroebe/utility_scripts/find_gene.rb', line 48 def reset super() # ======================================================================= # # === @start_codon_positions # ======================================================================= # @start_codon_positions = [] # This will contain the start codons. # ======================================================================= # # === @stop_codon_positions # ======================================================================= # @stop_codon_positions = [] if stop_codons?.empty? # ===================================================================== # # Determine the stop-codons in this case. # ===================================================================== # ::Bioroebe.determine_the_stop_codons end end |
#run ⇒ Object
#
run (run tag)
#
187 188 189 190 191 |
# File 'lib/bioroebe/utility_scripts/find_gene.rb', line 187 def run check_whether_we_have_dna_as_input # Must check if we have RNA or DNA as input. process_string report_gene end |
#set_input(i = '') ⇒ Object
#
set_input
#
79 80 81 82 83 84 |
# File 'lib/bioroebe/utility_scripts/find_gene.rb', line 79 def set_input(i = '') i = i.first if i.is_a? Array i = i.dup if i i = DEFAULT_STRING if i.nil? @input = i end |
#start_codon? ⇒ Boolean Also known as: start_codons?
#
start_codon?
Only give back the first instance of any start codon found.
#
133 134 135 |
# File 'lib/bioroebe/utility_scripts/find_gene.rb', line 133 def start_codon? ::Bioroebe.start_codon? end |
#start_stop? ⇒ Boolean
#
start_stop?
Return an Array with the start and stop codon position.
#
124 125 126 |
# File 'lib/bioroebe/utility_scripts/find_gene.rb', line 124 def start_stop? [ start_codon?, stop_codon? ] end |
#stop_codon? ⇒ Boolean
#
stop_codon?
Only give back the first instance of any stop codon found.
#
115 116 117 |
# File 'lib/bioroebe/utility_scripts/find_gene.rb', line 115 def stop_codon? @stop_codon_positions.first end |
#stop_codons? ⇒ Boolean
#
stop_codons?
This getter-method will return which stop-codons exist for the given organism at hand.
#
72 73 74 |
# File 'lib/bioroebe/utility_scripts/find_gene.rb', line 72 def stop_codons? ::Bioroebe.stop_codons? end |