Class: Bioroebe::Ruler
- Inherits:
-
CommandlineApplication
- Object
- Base
- CommandlineApplication
- Bioroebe::Ruler
- Defined in:
- lib/bioroebe/misc/ruler.rb
Overview
Bioroebe::Ruler
Constant Summary
Constants inherited from CommandlineApplication
CommandlineApplication::OLD_VERBOSE_VALUE
Constants included from ColoursForBase
ColoursForBase::ARRAY_HTML_COLOURS_IN_USE
Constants inherited from Base
Instance Method Summary collapse
-
#initialize(for_this_sequence = ARGV, group_together_n_nucleotides = 72, run_already = true) ⇒ Ruler
constructor
# === initialize.
-
#main_sequence? ⇒ Boolean
# === main_sequence? ========================================================================= #.
-
#reset ⇒ Object
# === reset ========================================================================= #.
-
#result? ⇒ Boolean
# === result? ========================================================================= #.
-
#result_as_string? ⇒ Boolean
(also: #result_as_string)
# === result_as_string? ========================================================================= #.
-
#run ⇒ Object
# === run ========================================================================= #.
-
#set_group_together_n_nucleotides(i = 72) ⇒ Object
# === set_group_together_n_nucleotides ========================================================================= #.
-
#set_use_this_sequence(i) ⇒ Object
# === set_use_this_sequence ========================================================================= #.
Methods inherited from CommandlineApplication
#all_aminoacids?, #append_what_into, #at_home?, #be_silent, #be_verbose?, #cat, #ccliner, #change_directory, #cliner, #codon_table_dataset?, #codon_to_aminoacid, #codons_for?, #colourize_this_dna_sequence, #complement, #cp, #disable_warnings, #download_dir?, #editor?, #enable_warnings, #ensure_that_the_base_directories_exist, #esystem, #extract, #is_this_a_start_codon?, #is_this_a_stop_codon?, #leading_five_prime, #load_bioroebe_yaml_file, #log_directory?, #one_letter_to_long_name, #one_to_three, #only_numbers?, #open_in_browser, #opnerev, #opnn, #pad_with_double_quotes, #pad_with_single_quotes, #partner_nucleotide, #remove_numbers, #remove_trailing_ansii_escape_code, #return_all_possible_start_codons, #return_array_of_one_letter_aminoacids, #return_cheerful_person, #return_chunked_display, #return_ubiquitin_sequence, #runmode?, #set_be_verbose, #set_runmode, #start_codon?, #stop_codons?, #strict_filter_away_invalid_aminoacids, #taxonomy_download_directory?, #three_to_one, #to_rna, #trailing_three_prime, #use_opn?, #verbose_truth, #was_or_were, #without_extname, #write_what_into
Methods included from BaseModule
#absolute_path, #default_file_read, #file_readlines
Methods included from CommandlineArguments
#commandline_arguments?, #commandline_arguments_that_are_files?, #e, #first?, #first_non_hyphen_argument?, #remove_hyphens_from_the_commandline_arguments, #return_commandline_arguments_as_string, #return_commandline_arguments_that_are_not_files, #return_entries_without_two_leading_hyphens, #select_commandline_arguments, #select_entries_starting_with_two_hyphens, #set_commandline_arguments
Methods included from ColoursForBase
#colourize_this_aminoacid_sequence_for_the_commandline, #colourize_this_nucleotide_sequence, #disable_colours, #ecomment, #efancy, #egold, #enable_colours, #eorange, #eparse, #erev, #red, #remove_trailing_escape_part, #return_colour_for_nucleotides, #rev, #sdir, #set_will_we_use_colours, #sfancy, #sfile, #simp, #swarn, #use_colours?, #use_colours_within_the_bioroebe_namespace?
Methods inherited from Base
#append_what_into, #can_base_pair?, #convert_global_env, #delete_file, #directory_to_the_codon_tables?, #is_on_roebe?, #is_palindrome?, #main_encoding?, #mkdir, #move_file, #mv, #no_file_exists_at, #no_newlines, #project_yaml_directory?, #rds, #register_sigint, #return_pwd, #return_the_first_line_of_this_file, #word_wrap, #write_what_into
Methods included from InternalHashModule
#internal_hash?, #reset_the_internal_hash
Methods included from InferTheNamespaceModule
#infer_the_namespace, #namespace?
Constructor Details
#initialize(for_this_sequence = ARGV, group_together_n_nucleotides = 72, run_already = true) ⇒ Ruler
#
initialize
The second argument determines which grouping is to be applied, that is, how many nucleotides are shown per line.
#
43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 |
# File 'lib/bioroebe/misc/ruler.rb', line 43 def initialize( for_this_sequence = ARGV, group_together_n_nucleotides = 72, run_already = true ) reset set_use_this_sequence( for_this_sequence ) # ======================================================================= # # The next method can be used to determine how many nucleotides # are to be displayed. # ======================================================================= # set_group_together_n_nucleotides( group_together_n_nucleotides ) # ======================================================================= # # === Handle blocks next # ======================================================================= # if block_given? yielded = yield # ===================================================================== # # === Handle Hashes next # ===================================================================== # if yielded.is_a? Hash # =================================================================== # # === :ruler # =================================================================== # if yielded.has_key? :ruler _ = yielded.delete(:ruler) case _ # ================================================================= # # === :no_colours # ================================================================= # when :no_colours, :without_colours @internal_hash[:highlight_numbers] = false end end else case yielded # =================================================================== # # === :no_colours # =================================================================== # when :no_colours, :without_colours @internal_hash[:highlight_numbers] = false end end end run if run_already end |
Instance Method Details
#main_sequence? ⇒ Boolean
#
main_sequence?
#
145 146 147 |
# File 'lib/bioroebe/misc/ruler.rb', line 145 def main_sequence? @use_this_sequence end |
#reset ⇒ Object
#
reset
#
99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 |
# File 'lib/bioroebe/misc/ruler.rb', line 99 def reset super() # ======================================================================= # # === @result # ======================================================================= # @result = [] # ======================================================================= # # === @group_together_n_nucleotides # ======================================================================= # @group_together_n_nucleotides = 72 # ======================================================================= # # If the next variable is set to true then we will highlight the # positions at 1, 5 and 10. This can be toggled to false by the user. # ======================================================================= # @internal_hash[:highlight_numbers] = true end |
#result? ⇒ Boolean
#
result?
#
152 153 154 |
# File 'lib/bioroebe/misc/ruler.rb', line 152 def result? @result end |
#result_as_string? ⇒ Boolean Also known as: result_as_string
#
result_as_string?
#
159 160 161 |
# File 'lib/bioroebe/misc/ruler.rb', line 159 def result_as_string? @result.join.strip end |
#run ⇒ Object
#
run
#
166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 |
# File 'lib/bioroebe/misc/ruler.rb', line 166 def run chunks = main_sequence?.to_s.split(/(.{#{@group_together_n_nucleotides}})/).reject(&:empty?) array = chunks.each_slice(@group_together_n_nucleotides).to_a.flatten # ======================================================================= # # We now have an array of chunks, such as: # # ["TGCGCAGGAGGACGAGGACGGCGACTACGAGGAGCTGGTGCTAGCCTTGCGTTCCGAGGAGGACGGCCTG", # "GCCGAAGCACCCGAGCACGGAACCACAGCCA"] # # ======================================================================= # array.each {|sequence| # Each entry will be a sequence of strings. _ = ''.dup sequence.chars.each_with_index {|char, index| index += 1 result = index % 10 if @internal_hash[:highlight_numbers] case result when 1 result = crimson(result)+rev when 5, 0 result = royalblue(result)+rev else result = result.to_s end end _ << result.to_s } @result << _ } end |
#set_group_together_n_nucleotides(i = 72) ⇒ Object
#
set_group_together_n_nucleotides
#
119 120 121 122 123 124 125 126 127 128 129 130 |
# File 'lib/bioroebe/misc/ruler.rb', line 119 def set_group_together_n_nucleotides( i = 72 ) case i # ======================================================================= # # === :default # ======================================================================= # when :default i = 72 end @group_together_n_nucleotides = i end |
#set_use_this_sequence(i) ⇒ Object
#
set_use_this_sequence
#
135 136 137 138 139 140 |
# File 'lib/bioroebe/misc/ruler.rb', line 135 def set_use_this_sequence(i) if i.is_a? Array i = i.join(' ').strip end @use_this_sequence = i end |