Class: Bio::Sequence::NA
- Inherits:
-
String
- Object
- String
- Bio::Sequence::NA
- Includes:
- Common
- Defined in:
- lib/bio/sequence/na.rb,
lib/bio/sequence/compat.rb
Overview
DESCRIPTION
Bio::Sequence::NA represents a bare Nucleic Acid sequence in bioruby.
USAGE
# Create a Nucleic Acid sequence.
dna = Bio::Sequence.auto('atgcatgcATGCATGCAAAA')
rna = Bio::Sequence.auto('augcaugcaugcaugcaaaa')
# What are the names of all the bases?
puts dna.names
puts rna.names
# What is the GC percentage?
puts dna.gc_percent
puts rna.gc_percent
# What is the molecular weight?
puts dna.molecular_weight
puts rna.molecular_weight
# What is the reverse complement?
puts dna.reverse_complement
puts dna.complement
# Is this sequence DNA or RNA?
puts dna.rna?
# Translate my sequence (see method docs for many options)
puts dna.translate
puts rna.translate
Direct Known Subclasses
Class Method Summary collapse
-
.randomize(*arg, &block) ⇒ Object
Generate a new random sequence with the given frequency of bases.
Instance Method Summary collapse
-
#at_content ⇒ Object
Calculate the ratio of AT / ATGC bases.
-
#at_skew ⇒ Object
Calculate the ratio of (A - T) / (A + T) bases.
-
#codon_usage ⇒ Object
Returns counts of each codon in the sequence in a hash.
-
#cut_with_enzyme(*args) ⇒ Object
(also: #cut_with_enzymes)
Example:.
-
#dna ⇒ Object
Returns a new sequence object with any ‘u’ bases changed to ‘t’.
-
#dna! ⇒ Object
Changes any ‘u’ bases in the original sequence to ‘t’.
-
#forward_complement ⇒ Object
Returns a new complementary sequence object (without reversing).
-
#forward_complement! ⇒ Object
Converts the current sequence into its complement (without reversing).
-
#gc_content ⇒ Object
Calculate the ratio of GC / ATGC bases.
-
#gc_percent ⇒ Object
Calculate the ratio of GC / ATGC bases as a percentage rounded to the nearest whole number.
-
#gc_skew ⇒ Object
Calculate the ratio of (G - C) / (G + C) bases.
-
#illegal_bases ⇒ Object
Returns an alphabetically sorted array of any non-standard bases (other than ‘atgcu’).
-
#initialize(str) ⇒ NA
constructor
Generate an nucleic acid sequence object from a string.
-
#molecular_weight ⇒ Object
Estimate molecular weight (using the values from BioPerl’s SeqStats.pm module).
-
#names ⇒ Object
Generate the list of the names of each nucleotide along with the sequence (full name).
-
#pikachu ⇒ Object
:nodoc:.
-
#reverse_complement ⇒ Object
(also: #complement)
Returns a new sequence object with the reverse complement sequence to the original.
-
#reverse_complement! ⇒ Object
(also: #complement!)
Converts the original sequence into its reverse complement.
-
#rna ⇒ Object
Returns a new sequence object with any ‘t’ bases changed to ‘u’.
-
#rna! ⇒ Object
Changes any ‘t’ bases in the original sequence to ‘u’.
-
#splicing(position) ⇒ Object
Alias of Bio::Sequence::Common splice method, documented there.
-
#to_re ⇒ Object
Create a ruby regular expression instance (Regexp) .
-
#translate(frame = 1, table = 1, unknown = 'X') ⇒ Object
Translate into an amino acid sequence.
Methods included from Common
#+, #<<, #composition, #concat, #normalize!, #randomize, #seq, #splice, #split, #subseq, #to_fasta, #to_s, #total, #window_search
Constructor Details
#initialize(str) ⇒ NA
Generate an nucleic acid sequence object from a string.
s = Bio::Sequence::NA.new("aagcttggaccgttgaagt")
or maybe (if you have an nucleic acid sequence in a file)
s = Bio::Sequence:NA.new(File.open('dna.txt').read)
Nucleic Acid sequences are always all lowercase in bioruby
s = Bio::Sequence::NA.new("AAGcTtGG")
puts s #=> "aagcttgg"
Whitespace is stripped from the sequence
seq = Bio::Sequence::NA.new("atg\nggg\ttt\r gc")
puts s #=> "atggggttgc"
Arguments:
-
(required) str: String
- Returns
-
Bio::Sequence::NA object
75 76 77 78 79 |
# File 'lib/bio/sequence/na.rb', line 75 def initialize(str) super self.downcase! self.tr!(" \t\n\r",'') end |
Class Method Details
.randomize(*arg, &block) ⇒ Object
Generate a new random sequence with the given frequency of bases. The sequence length is determined by their cumulative sum. (See also Bio::Sequence::Common#randomize which creates a new randomized sequence object using the base composition of an existing sequence instance).
counts = {'a'=>1,'c'=>2,'g'=>3,'t'=>4}
puts Bio::Sequence::NA.randomize(counts) #=> "ggcttgttac" (for example)
You may also feed the output of randomize into a block
actual_counts = {'a'=>0, 'c'=>0, 'g'=>0, 't'=>0}
Bio::Sequence::NA.randomize(counts) {|x| actual_counts[x] += 1}
actual_counts #=> {"a"=>1, "c"=>2, "g"=>3, "t"=>4}
Arguments:
-
(optional) hash: Hash object
- Returns
-
Bio::Sequence::NA object
82 83 84 |
# File 'lib/bio/sequence/compat.rb', line 82 def self.randomize(*arg, &block) self.new('').randomize(*arg, &block) end |
Instance Method Details
#at_content ⇒ Object
Calculate the ratio of AT / ATGC bases. U is regarded as T.
s = Bio::Sequence::NA.new('atggcgtga')
puts s.at_content #=> 4/9
puts s.at_content.to_f #=> 0.444444444444444
In older Ruby versions, Float is always returned.
s = Bio::Sequence::NA.new('atggcgtga')
puts s.at_content #=> 0.444444444444444
Note that “u” is regarded as “t”. If there are no ATGC bases in the sequence, 0.0 is returned.
- Returns
-
Rational or Float
346 347 348 349 350 351 352 353 |
# File 'lib/bio/sequence/na.rb', line 346 def at_content count = self.composition at = count['a'] + count['t'] + count['u'] gc = count['g'] + count['c'] total = at + gc return 0.0 if total == 0 return at.quo(total) end |
#at_skew ⇒ Object
Calculate the ratio of (A - T) / (A + T) bases. U is regarded as T.
s = Bio::Sequence::NA.new('atgttgttgttc')
puts s.at_skew #=> (-3/4)
puts s.at_skew.to_f #=> -0.75
In older Ruby versions, Float is always returned.
s = Bio::Sequence::NA.new('atgttgttgttc')
puts s.at_skew #=> -0.75
Note that “u” is regarded as “t”. If there are no AT bases in the sequence, 0.0 is returned.
- Returns
-
Rational or Float
395 396 397 398 399 400 401 402 |
# File 'lib/bio/sequence/na.rb', line 395 def at_skew count = self.composition a = count['a'] t = count['t'] + count['u'] at = a + t return 0.0 if at == 0 return (a - t).quo(at) end |
#codon_usage ⇒ Object
Returns counts of each codon in the sequence in a hash.
s = Bio::Sequence::NA.new('atggcgtga')
puts s.codon_usage #=> {"gcg"=>1, "tga"=>1, "atg"=>1}
This method does not validate codons! Any three letter group is a ‘codon’. So,
s = Bio::Sequence::NA.new('atggNNtga')
puts s.codon_usage #=> {"tga"=>1, "gnn"=>1, "atg"=>1}
seq = Bio::Sequence::NA.new('atgg--tga')
puts s.codon_usage #=> {"tga"=>1, "g--"=>1, "atg"=>1}
Also, there is no option to work in any frame other than the first.
- Returns
-
Hash object
273 274 275 276 277 278 279 |
# File 'lib/bio/sequence/na.rb', line 273 def codon_usage hash = Hash.new(0) self.window_search(3, 3) do |codon| hash[codon] += 1 end return hash end |
#cut_with_enzyme(*args) ⇒ Object Also known as: cut_with_enzymes
530 531 532 |
# File 'lib/bio/sequence/na.rb', line 530 def cut_with_enzyme(*args) Bio::RestrictionEnzyme::Analysis.cut(self, *args) end |
#dna ⇒ Object
474 475 476 |
# File 'lib/bio/sequence/na.rb', line 474 def dna self.tr('u', 't') end |
#dna! ⇒ Object
486 487 488 |
# File 'lib/bio/sequence/na.rb', line 486 def dna! self.tr!('u', 't') end |
#forward_complement ⇒ Object
100 101 102 103 104 |
# File 'lib/bio/sequence/na.rb', line 100 def forward_complement s = self.class.new(self) s.forward_complement! s end |
#forward_complement! ⇒ Object
114 115 116 117 118 119 120 121 |
# File 'lib/bio/sequence/na.rb', line 114 def forward_complement! if self.rna? self.tr!('augcrymkdhvbswn', 'uacgyrkmhdbvswn') else self.tr!('atgcrymkdhvbswn', 'tacgyrkmhdbvswn') end self end |
#gc_content ⇒ Object
Calculate the ratio of GC / ATGC bases. U is regarded as T.
s = Bio::Sequence::NA.new('atggcgtga')
puts s.gc_content #=> (5/9)
puts s.gc_content.to_f #=> 0.5555555555555556
In older Ruby versions, Float is always returned.
s = Bio::Sequence::NA.new('atggcgtga')
puts s.gc_content #=> 0.555555555555556
Note that “u” is regarded as “t”. If there are no ATGC bases in the sequence, 0.0 is returned.
- Returns
-
Rational or Float
321 322 323 324 325 326 327 328 |
# File 'lib/bio/sequence/na.rb', line 321 def gc_content count = self.composition at = count['a'] + count['t'] + count['u'] gc = count['g'] + count['c'] total = at + gc return 0.0 if total == 0 return gc.quo(total) end |
#gc_percent ⇒ Object
Calculate the ratio of GC / ATGC bases as a percentage rounded to the nearest whole number. U is regarded as T.
s = Bio::Sequence::NA.new('atggcgtga')
puts s.gc_percent #=> 55
Note that this method only returns an integer value. When more digits after decimal points are needed, use gc_content and sprintf like below:
s = Bio::Sequence::NA.new('atggcgtga')
puts sprintf("%3.2f", s.gc_content * 100) #=> "55.56"
- Returns
-
Fixnum
296 297 298 299 300 301 302 303 |
# File 'lib/bio/sequence/na.rb', line 296 def gc_percent count = self.composition at = count['a'] + count['t'] + count['u'] gc = count['g'] + count['c'] return 0 if at + gc == 0 gc = 100 * gc / (at + gc) return gc end |
#gc_skew ⇒ Object
Calculate the ratio of (G - C) / (G + C) bases.
s = Bio::Sequence::NA.new('atggcgtga')
puts s.gc_skew #=> 3/5
puts s.gc_skew.to_f #=> 0.6
In older Ruby versions, Float is always returned.
s = Bio::Sequence::NA.new('atggcgtga')
puts s.gc_skew #=> 0.6
If there are no GC bases in the sequence, 0.0 is returned.
- Returns
-
Rational or Float
370 371 372 373 374 375 376 377 |
# File 'lib/bio/sequence/na.rb', line 370 def gc_skew count = self.composition g = count['g'] c = count['c'] gc = g + c return 0.0 if gc == 0 return (g - c).quo(gc) end |
#illegal_bases ⇒ Object
411 412 413 |
# File 'lib/bio/sequence/na.rb', line 411 def illegal_bases self.scan(/[^atgcu]/).sort.uniq end |
#molecular_weight ⇒ Object
Estimate molecular weight (using the values from BioPerl’s SeqStats.pm module).
s = Bio::Sequence::NA.new('atggcgtga')
puts s.molecular_weight #=> 2841.00708
RNA and DNA do not have the same molecular weights,
s = Bio::Sequence::NA.new('auggcguga')
puts s.molecular_weight #=> 2956.94708
- Returns
-
Float object
427 428 429 430 431 432 433 |
# File 'lib/bio/sequence/na.rb', line 427 def molecular_weight if self.rna? Bio::NucleicAcid.weight(self, true) else Bio::NucleicAcid.weight(self) end end |
#names ⇒ Object
458 459 460 461 462 463 464 |
# File 'lib/bio/sequence/na.rb', line 458 def names array = [] self.each_byte do |x| array.push(Bio::NucleicAcid.names[x.chr.upcase]) end return array end |
#pikachu ⇒ Object
:nodoc:
86 87 88 |
# File 'lib/bio/sequence/compat.rb', line 86 def pikachu #:nodoc: self.dna.tr("atgc", "pika") # joke, of course :-) end |
#reverse_complement ⇒ Object Also known as: complement
131 132 133 134 135 |
# File 'lib/bio/sequence/na.rb', line 131 def reverse_complement s = self.class.new(self) s.reverse_complement! s end |
#reverse_complement! ⇒ Object Also known as: complement!
145 146 147 148 |
# File 'lib/bio/sequence/na.rb', line 145 def reverse_complement! self.reverse! self.forward_complement! end |
#rna ⇒ Object
498 499 500 |
# File 'lib/bio/sequence/na.rb', line 498 def rna self.tr('t', 'u') end |
#rna! ⇒ Object
510 511 512 |
# File 'lib/bio/sequence/na.rb', line 510 def rna! self.tr!('t', 'u') end |
#splicing(position) ⇒ Object
Alias of Bio::Sequence::Common splice method, documented there.
82 83 84 85 86 87 88 89 90 |
# File 'lib/bio/sequence/na.rb', line 82 def splicing(position) #:nodoc: mRNA = super if mRNA.rna? mRNA.tr!('t', 'u') else mRNA.tr!('u', 't') end mRNA end |
#to_re ⇒ Object
442 443 444 445 446 447 448 |
# File 'lib/bio/sequence/na.rb', line 442 def to_re if self.rna? Bio::NucleicAcid.to_re(self.dna, true) else Bio::NucleicAcid.to_re(self) end end |
#translate(frame = 1, table = 1, unknown = 'X') ⇒ Object
Translate into an amino acid sequence.
s = Bio::Sequence::NA.new('atggcgtga')
puts s.translate #=> "MA*"
By default, translate starts in reading frame position 1, but you can start in either 2 or 3 as well,
puts s.translate(2) #=> "WR"
puts s.translate(3) #=> "GV"
You may also translate the reverse complement in one step by using frame values of -1, -2, and -3 (or 4, 5, and 6)
puts s.translate(-1) #=> "SRH"
puts s.translate(4) #=> "SRH"
puts s.reverse_complement.translate(1) #=> "SRH"
The default codon table in the translate function is the Standard Eukaryotic codon table. The translate function takes either a number or a Bio::CodonTable object for its table argument. The available tables are (NCBI):
1. "Standard (Eukaryote)"
2. "Vertebrate Mitochondrial"
3. "Yeast Mitochondorial"
4. "Mold, Protozoan, Coelenterate Mitochondrial and Mycoplasma/Spiroplasma"
5. "Invertebrate Mitochondrial"
6. "Ciliate Macronuclear and Dasycladacean"
9. "Echinoderm Mitochondrial"
10. "Euplotid Nuclear"
11. "Bacteria"
12. "Alternative Yeast Nuclear"
13. "Ascidian Mitochondrial"
14. "Flatworm Mitochondrial"
15. "Blepharisma Macronuclear"
16. "Chlorophycean Mitochondrial"
21. "Trematode Mitochondrial"
22. "Scenedesmus obliquus mitochondrial"
23. "Thraustochytrium Mitochondrial"
If you are using anything other than the default table, you must specify frame in the translate method call,
puts s.translate #=> "MA*" (using defaults)
puts s.translate(1,1) #=> "MA*" (same as above, but explicit)
puts s.translate(1,2) #=> "MAW" (different codon table)
and using a Bio::CodonTable instance in the translate method call,
mt_table = Bio::CodonTable[2]
puts s.translate(1, mt_table) #=> "MAW"
By default, any invalid or unknown codons (as could happen if the sequence contains ambiguities) will be represented by ‘X’ in the translated sequence. You may change this to any character of your choice.
s = Bio::Sequence::NA.new('atgcNNtga')
puts s.translate #=> "MX*"
puts s.translate(1,1,'9') #=> "M9*"
The translate method considers gaps to be unknown characters and treats them as such (i.e. does not collapse sequences prior to translation), so
s = Bio::Sequence::NA.new('atgc--tga')
puts s.translate #=> "MX*"
Arguments:
-
(optional) frame: one of 1,2,3,4,5,6,-1,-2,-3 (default 1)
-
(optional) table: Fixnum in range 1,23 or Bio::CodonTable object (default 1)
-
(optional) unknown: Character (default ‘X’)
- Returns
-
Bio::Sequence::AA object
232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 |
# File 'lib/bio/sequence/na.rb', line 232 def translate(frame = 1, table = 1, unknown = 'X') if table.is_a?(Bio::CodonTable) ct = table else ct = Bio::CodonTable[table] end naseq = self.dna case frame when 1, 2, 3 from = frame - 1 when 4, 5, 6 from = frame - 4 naseq.complement! when -1, -2, -3 from = -1 - frame naseq.complement! else from = 0 end nalen = naseq.length - from nalen -= nalen % 3 aaseq = naseq[from, nalen].gsub(/.{3}/) {|codon| ct[codon] or unknown} return Bio::Sequence::AA.new(aaseq) end |