Class: ViralSeq::SeqHash
- Inherits:
-
Object
- Object
- ViralSeq::SeqHash
- Defined in:
- lib/viral_seq/seq_hash.rb,
lib/viral_seq/hivdr.rb
Overview
ViralSeq::SeqHash class for operation on multiple sequences.
Instance Attribute Summary collapse
-
#aa_hash ⇒ Hash
Hash object for :name => :amino_acid_sequence_string pairs.
-
#dna_hash ⇒ Hash
Hash object for :name => :sequence_string pairs.
-
#file ⇒ String
The file that is used to initialize SeqHash object, if it exists.
-
#qc_hash ⇒ Hash
Hash object for :name => :qc_score_string pairs.
-
#title ⇒ String
default as the file basename if SeqHash object is initialized using ::fa or ::fq.
Class Method Summary collapse
-
.new_from_aa_fasta(infile) ⇒ ViralSeq::SeqHash
(also: aa_fa)
initialize a new ViralSeq::SeqHash object from a FASTA format sequence file of amino acid sequences.
-
.new_from_array(seq_array, master_tag = 'seq') ⇒ ViralSeq::SeqHash
(also: array)
initialize a ViralSeq::SeqHash object with an array of sequence strings.
-
.new_from_fasta(infile) ⇒ ViralSeq::SeqHash
(also: fa)
initialize a new ViralSeq::SeqHash object from a FASTA format sequence file.
-
.new_from_fastq(fastq_file) ⇒ ViralSeq::SeqHash
(also: fq)
initialize a new ViralSeq::SeqHash object from a FASTQ format sequence file.
Instance Method Summary collapse
-
#+(sh2) ⇒ ViralSeq::SeqHash
combine SeqHash objects.
-
#a3g_hypermut ⇒ Hash
(also: #a3g)
function to determine if the sequences have APOBEC3g/f hypermutation.
-
#align(path_to_muscle = false) ⇒ SeqHash
align the @dna_hash sequences, return a new ViralSeq::SeqHash object with aligned @dna_hash using MUSCLE.
-
#collapse(cutoff = 1) ⇒ ViralSeq::SeqHash
Collapse sequences by difference cut-offs.
-
#consensus(cutoff = 0.5) ⇒ String
create one consensus sequence from @dna_hash with an optional majority cut-off for mixed bases.
-
#error_table(ref = self.consensus, head = true) ⇒ Array
return an table of frequencies of nucleotides at each position.
-
#filter_similar_pid(cutoff = 10) ⇒ ViralSeq::SeqHash
Remove sequences with residual offspring Primer IDs.
-
#gap_strip(option = :nt) ⇒ ViralSeq::SeqHash
gap strip from a sequence alignment, all positions that contains gaps (‘-’) will be removed.
-
#gap_strip_ends(option = :nt) ⇒ ViralSeq::SeqHash
gap strip from a sequence alignment at both ends, only positions at the ends that contains gaps (‘-’) will be removed.
-
#hiv_seq_qc(start_nt, end_nt, indel = true, ref_option = :HXB2, path_to_muscle = false) ⇒ ViralSeq::SeqHash
quality check for HIV sequences based on ViralSeq::Sequence#locator, check if sequences are in the target range.
-
#initialize(dna_hash = {}, aa_hash = {}, qc_hash = {}, title = "", file = "") ⇒ SeqHash
constructor
initialize a ViralSeq::SeqHash object.
-
#mutation(error_rate = 0.01) ⇒ ViralSeq::SeqHash
mutate @dna_hash based on the error_rate.
-
#nucleotide_pi ⇒ Float
(also: #pi)
Function to calculate nucleotide diversity π, for nt sequence only.
-
#poisson_minority_cutoff(error_rate = 0.0001, fold_cutoff = 20) ⇒ Integer
(also: #pm)
Define Poission cut-off for minority variants.
-
#random_select(n = 100) ⇒ ViralSeq::SeqHash
randomly select n number of sequences from the orginal SeqHash object.
-
#sample(n = 1) ⇒ ViralSeq::SeqHash
sample a certain number of sequences from a SeqHash object.
-
#sdrm_hiv_in(cutoff = 0) ⇒ Array
functions to identify SDRMs from a ViralSeq::SeqHash object at HIV IN region.
-
#sdrm_hiv_pr(cutoff = 0) ⇒ Array
functions to identify SDRMs from a ViralSeq::SeqHash object at HIV PR region.
-
#sdrm_hiv_rt(cutoff = 0) ⇒ Array
functions to identify SDRMs from a ViralSeq::SeqHash object at HIV RT region.
-
#sequence_locator(ref_option = :HXB2) ⇒ Array
(also: #loc)
sequence locator for SeqHash object, resembling HIV Sequence Locator from LANL.
-
#shannons_entropy(option = :nt) ⇒ Hash
calculate Shannon’s entropy, Euler’s number as the base of logarithm.
-
#size ⇒ Integer
the size of nt sequence hash of the SeqHash object.
-
#stop_codon(codon_position = 0) ⇒ Hash
screen for sequences with stop codons.
-
#sub(keys) ⇒ SeqHash
given an Array of sequence tags, return a sub ViralSeq::SeqHash object with the sequence tags.
-
#tn93 ⇒ Hash
TN93 distance functionl, tabulate pairwise comparison of sequence pairs in a sequence alignment, nt sequence only.
-
#to_rsphylip ⇒ String
generate sequences in relaxed sequencial phylip format from a ViralSeq::SeqHash object.
-
#translate(codon_position = 0) ⇒ NilClass
translate the DNA sequences in @dna_hash to amino acid sequences.
-
#trim(start_nt, end_nt, ref_option = :HXB2, path_to_muscle = false) ⇒ ViralSeq::SeqHash
trim dna sequences based on the provided reference coordinates.
-
#uniq_dna_hash(tag = "sequence") ⇒ ViralSeq::SeqHash
(also: #uniq)
collapse @dna_hash to unique sequence hash.
-
#write_nt_fa(file) ⇒ NilClass
write the nt sequences to a FASTA format file.
Constructor Details
#initialize(dna_hash = {}, aa_hash = {}, qc_hash = {}, title = "", file = "") ⇒ SeqHash
initialize a ViralSeq::SeqHash object
25 26 27 28 29 30 31 |
# File 'lib/viral_seq/seq_hash.rb', line 25 def initialize (dna_hash = {}, aa_hash = {}, qc_hash = {}, title = "", file = "") @dna_hash = dna_hash @aa_hash = aa_hash @qc_hash = qc_hash @title = title @file = file end |
Instance Attribute Details
#aa_hash ⇒ Hash
Returns Hash object for :name => :amino_acid_sequence_string pairs.
37 38 39 |
# File 'lib/viral_seq/seq_hash.rb', line 37 def aa_hash @aa_hash end |
#dna_hash ⇒ Hash
Returns Hash object for :name => :sequence_string pairs.
34 35 36 |
# File 'lib/viral_seq/seq_hash.rb', line 34 def dna_hash @dna_hash end |
#file ⇒ String
Returns the file that is used to initialize SeqHash object, if it exists.
47 48 49 |
# File 'lib/viral_seq/seq_hash.rb', line 47 def file @file end |
#qc_hash ⇒ Hash
Returns Hash object for :name => :qc_score_string pairs.
40 41 42 |
# File 'lib/viral_seq/seq_hash.rb', line 40 def qc_hash @qc_hash end |
#title ⇒ String
default as the file basename if SeqHash object is initialized using ::fa or ::fq
44 45 46 |
# File 'lib/viral_seq/seq_hash.rb', line 44 def title @title end |
Class Method Details
.new_from_aa_fasta(infile) ⇒ ViralSeq::SeqHash Also known as: aa_fa
initialize a new ViralSeq::SeqHash object from a FASTA format sequence file of amino acid sequences
82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 |
# File 'lib/viral_seq/seq_hash.rb', line 82 def self.new_from_aa_fasta(infile) f=File.open(infile,"r") return_hash = {} name = "" while line = f.gets do line.tr!("\u0000","") next if line == "\n" next if line =~ /^\=/ if line =~ /^\>/ name = line.chomp return_hash[name] = "" else return_hash[name] += line.chomp.upcase end end f.close seq_hash = ViralSeq::SeqHash.new seq_hash.aa_hash = return_hash seq_hash.title = File.basename(infile,".*") seq_hash.file = infile return seq_hash end |
.new_from_array(seq_array, master_tag = 'seq') ⇒ ViralSeq::SeqHash Also known as: array
initialize a ViralSeq::SeqHash object with an array of sequence strings
148 149 150 151 152 153 154 155 156 157 158 159 |
# File 'lib/viral_seq/seq_hash.rb', line 148 def self.new_from_array(seq_array,master_tag = 'seq') n = 1 hash = {} seq_array.each do |seq| hash[master_tag + "_" + n.to_s] = seq n += 1 end seq_hash = ViralSeq::SeqHash.new seq_hash.dna_hash = hash seq_hash.title = master_tag return seq_hash end |
.new_from_fasta(infile) ⇒ ViralSeq::SeqHash Also known as: fa
initialize a new ViralSeq::SeqHash object from a FASTA format sequence file
55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 |
# File 'lib/viral_seq/seq_hash.rb', line 55 def self.new_from_fasta(infile) f=File.open(infile,"r") return_hash = {} name = "" while line = f.gets do line.tr!("\u0000","") next if line == "\n" next if line =~ /^\=/ if line =~ /^\>/ name = line.chomp return_hash[name] = "" else return_hash[name] += line.chomp.upcase end end f.close seq_hash = ViralSeq::SeqHash.new seq_hash.dna_hash = return_hash seq_hash.title = File.basename(infile,".*") seq_hash.file = infile return seq_hash end |
.new_from_fastq(fastq_file) ⇒ ViralSeq::SeqHash Also known as: fq
initialize a new ViralSeq::SeqHash object from a FASTQ format sequence file
111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 |
# File 'lib/viral_seq/seq_hash.rb', line 111 def self.new_from_fastq(fastq_file) count = 0 sequence_a = [] quality_a = [] count_seq = 0 File.open(fastq_file,'r') do |file| file.readlines.collect do |line| count +=1 count_m = count % 4 if count_m == 1 line.tr!('@','>') sequence_a << line.chomp quality_a << line.chomp count_seq += 1 elsif count_m == 2 sequence_a << line.chomp elsif count_m == 0 quality_a << line.chomp end end end sequence_hash = Hash[sequence_a.each_slice(2).to_a] quality_hash = Hash[quality_a.each_slice(2).to_a] seq_hash = ViralSeq::SeqHash.new seq_hash.dna_hash = sequence_hash seq_hash.qc_hash = quality_hash seq_hash.title = File.basename(fastq_file,".*") seq_hash.file = fastq_file return seq_hash end |
Instance Method Details
#+(sh2) ⇒ ViralSeq::SeqHash
combine SeqHash objects
180 181 182 183 184 185 186 187 188 |
# File 'lib/viral_seq/seq_hash.rb', line 180 def +(sh2) new_seqhash = ViralSeq::SeqHash.new new_seqhash.dna_hash = self.dna_hash.merge(sh2.dna_hash) new_seqhash.aa_hash = self.aa_hash.merge(sh2.aa_hash) new_seqhash.qc_hash = self.qc_hash.merge(sh2.qc_hash) new_seqhash.title = self.title + "_with_" + sh2.title new_seqhash.file = self.file + "," + sh2.file return new_seqhash end |
#a3g_hypermut ⇒ Hash Also known as: a3g
function to determine if the sequences have APOBEC3g/f hypermutation.
# APOBEC3G/F pattern: GRD -> ARD
# control pattern: G[YN|RC] -> A[YN|RC]
# use the sample consensus to determine potential a3g sites
# Two criteria to identify hypermutation
# 1. Fisher's exact test on the frequencies of G to A mutation at A3G positions vs. non-A3G positions
# 2. Poisson distribution of G to A mutations at A3G positions, outliers sequences
# note: criteria 2 only applies on a sequence file containing more than 20 sequences,
# b/c Poisson model does not do well on small sample size.
460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 |
# File 'lib/viral_seq/seq_hash.rb', line 460 def a3g_hypermut # mut_hash number of apobec3g/f mutations per sequence mut_hash = {} hm_hash = {} out_hash = {} # total G->A mutations at apobec3g/f positions. total = 0 # make consensus sequence for the input sequence hash ref = self.consensus # obtain apobec3g positions and control positions apobec = apobec3gf(ref) mut = apobec[0] control = apobec[1] self.dna_hash.each do |k,v| a = 0 # muts b = 0 # potential mut sites c = 0 # control muts d = 0 # potenrial controls mut.each do |n| next if v[n] == "-" if v[n] == "A" a += 1 b += 1 else b += 1 end end mut_hash[k] = a total += a control.each do |n| next if v[n] == "-" if v[n] == "A" c += 1 d += 1 else d += 1 end end rr = (a/b.to_f)/(c/d.to_f) t1 = b - a t2 = d - c fet = ViralSeq::Rubystats::FishersExactTest.new fisher = fet.calculate(t1,t2,a,c) perc = fisher[:twotail] info = [k, a, b, c, d, rr.round(2), perc] out_hash[k] = info if perc < 0.05 hm_hash[k] = info end end if self.dna_hash.size > 20 rate = total.to_f/(self.dna_hash.size) count_mut = mut_hash.values.count_freq maxi_count = count_mut.values.max poisson_hash = ViralSeq::Math::PoissonDist.new(rate,maxi_count).poisson_hash cut_off = 0 poisson_hash.each do |k,v| cal = self.dna_hash.size * v obs = count_mut[k] if obs >= 20 * cal cut_off = k break elsif k == maxi_count cut_off = maxi_count end end mut_hash.each do |k,v| if v > cut_off hm_hash[k] = out_hash[k] end end end hm_seq_hash = ViralSeq::SeqHash.new hm_hash.each do |k,_v| hm_seq_hash.dna_hash[k] = self.dna_hash[k] end hm_seq_hash.title = self.title + "_hypermut" hm_seq_hash.file = self.file filtered_seq_hash = self.sub(self.dna_hash.keys - hm_hash.keys) return { a3g_seq: hm_seq_hash, filtered_seq: filtered_seq_hash, stats: hm_hash.values } end |
#align(path_to_muscle = false) ⇒ SeqHash
align the @dna_hash sequences, return a new ViralSeq::SeqHash object with aligned @dna_hash using MUSCLE
596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 |
# File 'lib/viral_seq/seq_hash.rb', line 596 def align(path_to_muscle = false) seq_hash = self.dna_hash if self.file.size > 0 temp_dir = File.dirname(self.file) else temp_dir=File.dirname($0) end temp_file = File.join(temp_dir, "_temp_muscle_in") temp_aln = File.join(temp_dir, "_temp_muscle_aln") File.open(temp_file, 'w'){|f| seq_hash.each {|k,v| f.puts k; f.puts v}} if path_to_muscle unless ViralSeq.check_muscle?(path_to_muscle) File.unlink(temp_file) return nil end print `#{path_to_muscle} -in #{temp_file} -out #{temp_aln} -quiet` else MuscleBio.run("muscle -in #{temp_file} -out #{temp_aln} -quiet") end out_seq_hash = ViralSeq::SeqHash.fa(temp_aln) out_seq_hash.title = self.title + "_aligned" out_seq_hash.file = self.file File.unlink(temp_file) File.unlink(temp_aln) return out_seq_hash end |
#collapse(cutoff = 1) ⇒ ViralSeq::SeqHash
Collapse sequences by difference cut-offs. Suggesting aligning before using this function.
902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 |
# File 'lib/viral_seq/seq_hash.rb', line 902 def collapse(cutoff=1) seq_array = self.dna_hash.values new_seq_freq = {} seq_freq = seq_array.count_freq if seq_freq.size == 1 new_seq_freq = seq_freq else uniq_seq = seq_freq.keys unique_seq_pair = uniq_seq.combination(2) dupli_seq = [] unique_seq_pair.each do |pair| seq1 = pair[0] seq2 = pair[1] diff = seq1.compare_with(seq2) if diff <= cutoff freq1 = seq_freq[seq1] freq2 = seq_freq[seq2] freq1 >= freq2 ? dupli_seq << seq2 : dupli_seq << seq1 end end seq_freq.each do |seq,freq| unless dupli_seq.include?(seq) new_seq_freq[seq] = freq end end end seqhash = ViralSeq::SeqHash.new n = 1 new_seq_freq.each do |seq,freq| name = ">seq_" + n.to_s + '_' + freq.to_s seqhash.dna_hash[name] = seq n += 1 end return seqhash end |
#consensus(cutoff = 0.5) ⇒ String
create one consensus sequence from @dna_hash with an optional majority cut-off for mixed bases.
392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 |
# File 'lib/viral_seq/seq_hash.rb', line 392 def consensus(cutoff = 0.5) seq_array = self.dna_hash.values seq_length = seq_array[0].size seq_size = seq_array.size consensus_seq = "" (0..(seq_length - 1)).each do |position| all_base = [] seq_array.each do |seq| all_base << seq[position] end base_count = all_base.count_freq max_base_list = [] if cutoff.zero? max_count = base_count.values.max max_base_hash = base_count.select {|_k,v| v == max_count} max_base_list = max_base_hash.keys else base_count.each do |k,v| if v/seq_size.to_f >= cutoff max_base_list << k end end end consensus_seq += call_consensus_base(max_base_list) end return consensus_seq end |
#error_table(ref = self.consensus, head = true) ⇒ Array
return an table of frequencies of nucleotides at each position.
1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137 1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155 1156 1157 1158 |
# File 'lib/viral_seq/seq_hash.rb', line 1118 def error_table(ref = self.consensus, head = true) table = [] if head table << %w{ position consensus total_seq_number A C G T } end ref_size = ref.size (0..(ref_size - 1)).each do |position| ref_base = ref[position] nts = [] self.dna_hash.each do |_k,v| nts << v[position] end freq = nts.count_freq freq2 = {} freq.each do |nt,c| if nt == ref_base freq2[nt] = '-' else freq2[nt] = (c/(self.size).to_f) end end table << [(position + 1),ref_base,self.size,freq2['A'],freq2['C'],freq2['G'],freq2['T']] end return table end |
#filter_similar_pid(cutoff = 10) ⇒ ViralSeq::SeqHash
Remove sequences with residual offspring Primer IDs.
Compare PID with sequences which have identical sequences.
PIDs differ by 1 base will be recognized. If PID1 is x time (cutoff) greater than PID2, PID2 will be disgarded.
each sequence tag starting with ">" and the Primer ID sequence
followed by the number of Primer ID appeared in the raw sequence
the information sections in the tags are separated by underscore "_"
example sequence tag: >AGGCGTAGA_32_sample1_RT
840 841 842 843 844 845 846 847 848 849 850 851 852 853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870 871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 |
# File 'lib/viral_seq/seq_hash.rb', line 840 def filter_similar_pid(cutoff = 10) seq = self.dna_hash.dup uni_seq = seq.values.uniq uni_seq_pid = {} uni_seq.each do |k| seq.each do |name,s| name = name[1..-1] if k == s if uni_seq_pid[k] uni_seq_pid[k] << [name.split("_")[0],name.split("_")[1]] else uni_seq_pid[k] = [] uni_seq_pid[k] << [name.split("_")[0],name.split("_")[1]] end end end end dup_pid = [] uni_seq_pid.values.each do |v| next if v.size == 1 pid_hash = Hash[v] list = pid_hash.keys list2 = Array.new(list) pairs = [] list.each do |k| list2.delete(k) list2.each do |k1| pairs << [k,k1] end end pairs.each do |p| pid1 = p[0] pid2 = p[1] if pid1.compare_with(pid2) <= 1 n1 = pid_hash[pid1].to_i n2 = pid_hash[pid2].to_i if n1 >= cutoff * n2 dup_pid << pid2 elsif n2 >= cutoff * n1 dup_pid << pid1 end end end end new_seq = {} seq.each do |name,s| pid = name.split("_")[0][1..-1] unless dup_pid.include?(pid) new_seq[name] = s end end self.sub(new_seq.keys) end |
#gap_strip(option = :nt) ⇒ ViralSeq::SeqHash
gap strip from a sequence alignment, all positions that contains gaps (‘-’) will be removed
957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 |
# File 'lib/viral_seq/seq_hash.rb', line 957 def gap_strip(option = :nt) if option == :nt sequence_alignment = self.dna_hash elsif option == :aa sequence_alignment = self.aa_hash else raise "Option `#{option}` not recognized" end new_seq = {} seq_size = sequence_alignment.values[0].size seq_matrix = {} (0..(seq_size - 1)).each do |p| seq_matrix[p] = [] sequence_alignment.values.each do |s| seq_matrix[p] << s[p] end end seq_matrix.delete_if do |_p, list| list.include?("-") end sequence_alignment.each do |n,s| new_s = "" seq_matrix.keys.each {|p| new_s += s[p]} new_seq[n] = new_s end new_seq_hash = ViralSeq::SeqHash.new if option == :nt new_seq_hash.dna_hash = new_seq new_seq_hash.aa_hash = self.aa_hash elsif option == :aa new_seq_hash.dna_hash = self.dna_hash new_seq_hash.aa_hash = new_seq end new_seq_hash.qc_hash = self.qc_hash new_seq_hash.title = self.title + "_strip" new_seq_hash.file = self.file return new_seq_hash end |
#gap_strip_ends(option = :nt) ⇒ ViralSeq::SeqHash
gap strip from a sequence alignment at both ends, only positions at the ends that contains gaps (‘-’) will be removed.
1016 1017 1018 1019 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041 1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 |
# File 'lib/viral_seq/seq_hash.rb', line 1016 def gap_strip_ends(option = :nt) if option == :nt sequence_alignment = self.dna_hash elsif option == :aa sequence_alignment = self.aa_hash else raise "Option #{option} not recognized" end new_seq = {} seq_size = sequence_alignment.values[0].size seq_matrix = {} (0..(seq_size - 1)).each do |p| seq_matrix[p] = [] sequence_alignment.values.each do |s| seq_matrix[p] << s[p] end end n1 = 0 n2 = 0 seq_matrix.each do |_p, list| if list.include?("-") n1 += 1 else break end end seq_matrix.keys.reverse.each do |p| list = seq_matrix[p] if list.include?("-") n2 += 1 else break end end sequence_alignment.each do |n,s| new_s = s[n1..(- n2 - 1)] new_seq[n] = new_s end new_seq_hash = ViralSeq::SeqHash.new if option == :nt new_seq_hash.dna_hash = new_seq new_seq_hash.aa_hash = self.aa_hash elsif option == :aa new_seq_hash.dna_hash = self.dna_hash new_seq_hash.aa_hash = new_seq end new_seq_hash.qc_hash = self.qc_hash new_seq_hash.title = self.title + "_strip" new_seq_hash.file = self.file return new_seq_hash end |
#hiv_seq_qc(start_nt, end_nt, indel = true, ref_option = :HXB2, path_to_muscle = false) ⇒ ViralSeq::SeqHash
quality check for HIV sequences based on ViralSeq::Sequence#locator, check if sequences are in the target range
755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 |
# File 'lib/viral_seq/seq_hash.rb', line 755 def hiv_seq_qc(start_nt, end_nt, indel=true, ref_option = :HXB2, path_to_muscle = false) start_nt = start_nt..start_nt if start_nt.is_a?(Integer) end_nt = end_nt..end_nt if end_nt.is_a?(Integer) seq_hash = self.dna_hash.dup seq_hash_unique = seq_hash.values.uniq seq_hash_unique_pass = [] seq_hash_unique.each do |seq| next if seq.nil? loc = ViralSeq::Sequence.new('', seq).locator(ref_option, path_to_muscle) next unless loc # if locator tool fails, skip this seq. if start_nt.include?(loc[0]) && end_nt.include?(loc[1]) if indel seq_hash_unique_pass << seq elsif loc[3] == false seq_hash_unique_pass << seq end end end seq_pass = [] seq_hash_unique_pass.each do |seq| seq_hash.each do |seq_name, orginal_seq| if orginal_seq == seq seq_pass << seq_name seq_hash.delete(seq_name) end end end self.sub(seq_pass) end |
#mutation(error_rate = 0.01) ⇒ ViralSeq::SeqHash
mutate @dna_hash based on the error_rate
1075 1076 1077 1078 1079 1080 1081 1082 1083 1084 1085 |
# File 'lib/viral_seq/seq_hash.rb', line 1075 def mutation(error_rate = 0.01) new_seqhash = ViralSeq::SeqHash.new dna = {} self.dna_hash.each do |name, seq| dna[name + '_mut-' + error_rate.to_s] = seq.mutation(error_rate) end new_seqhash.dna_hash = dna new_seqhash.title = self.title + "_mut-" + error_rate.to_s new_seqhash.file = self.file return new_seqhash end |
#nucleotide_pi ⇒ Float Also known as: pi
Function to calculate nucleotide diversity π, for nt sequence only
674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 |
# File 'lib/viral_seq/seq_hash.rb', line 674 def nucleotide_pi sequences = self.dna_hash.values seq_length = sequences[0].size - 1 nt_position_hash = {} (0..seq_length).each do |n| nt_position_hash[n] = [] sequences.each do |s| nt_position_hash[n] << s[n] end end diver = 0 com = 0 nt_position_hash.each do |_p,nt| nt.delete_if {|n| n =~ /[^A|^C|^G|^T]/} next if nt.size == 1 nt_count = nt.count_freq combination = (nt.size)*(nt.size - 1)/2 com += combination a = nt_count["A"] c = nt_count["C"] t = nt_count["T"] g = nt_count["G"] div = a*c + a*t + a*g + c*t + c*g + t*g diver += div end pi = (diver/com.to_f).round(5) return pi end |
#poisson_minority_cutoff(error_rate = 0.0001, fold_cutoff = 20) ⇒ Integer Also known as: pm
Define Poission cut-off for minority variants.
565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 |
# File 'lib/viral_seq/seq_hash.rb', line 565 def poisson_minority_cutoff(error_rate = 0.0001, fold_cutoff = 20) sequences = self.dna_hash.values if sequences.size == 0 return 0 else cut_off = Float::INFINITY l = sequences[0].size rate = sequences.size * error_rate count_mut = variant_for_poisson(sequences) max_count = count_mut.keys.max poisson_hash = ViralSeq::Math::PoissonDist.new(rate, max_count).poisson_hash poisson_hash.each do |k,v| cal = l * v obs = count_mut[k] ? count_mut[k] : 1 if obs >= fold_cutoff * cal cut_off = k break end end return cut_off end end |
#random_select(n = 100) ⇒ ViralSeq::SeqHash
randomly select n number of sequences from the orginal SeqHash object
1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 |
# File 'lib/viral_seq/seq_hash.rb', line 1164 def random_select(n = 100) new_sh = ViralSeq::SeqHash.new dna_hash = self.dna_hash aa_hash = self.aa_hash qc_hash = self.qc_hash keys = dna_hash.keys.sample(n) keys.each do |k| new_sh.dna_hash[k] = dna_hash[k] new_sh.aa_hash[k] = aa_hash[k] new_sh.qc_hash[k] = qc_hash[k] end new_sh.file = self.file new_sh.title = self.title + "_" + n.to_s return new_sh end |
#sample(n = 1) ⇒ ViralSeq::SeqHash
sample a certain number of sequences from a SeqHash object
194 195 196 197 198 199 200 201 202 203 204 205 206 207 |
# File 'lib/viral_seq/seq_hash.rb', line 194 def sample(n = 1) keys = self.dna_hash.keys sampled_keys = keys.sample(n) sampled_nt = {} sampled_aa = {} sampled_qc = {} sampled_title = self.title + "_sampled_" + n.to_s sampled_keys.each do |k| sampled_nt[k] = self.dna_hash[k] sampled_aa[k] = self.aa_hash[k] sampled_qc[k] = self.qc_hash[k] end return ViralSeq::SeqHash.new(sampled_nt, sampled_aa, sampled_qc, sampled_title, self.file) end |
#sdrm_hiv_in(cutoff = 0) ⇒ Array
functions to identify SDRMs from a ViralSeq::SeqHash object at HIV IN region.
works for MPID-DR protocol (dx.doi.org/10.17504/protocols.io.useewbe)
IN codon 53-174
368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 |
# File 'lib/viral_seq/hivdr.rb', line 368 def sdrm_hiv_in(cutoff = 0) sequences = self.dna_hash region = "IN" rf_label = 2 start_codon_number = 53 n_seq = sequences.size mut = {} mut_com = [] aa = {} point_mutation_list = [] sequences.each do |name,seq| s = ViralSeq::Sequence.new(name,seq) s.translate(rf_label) aa[name] = s.aa_string record = s.sdrm(:hiv_in, start_codon_number) mut_com << record record.each do |position,mutation| if mut[position] mut[position][1] << mutation[1] else mut[position] = [mutation[0],[]] mut[position][1] << mutation[1] end end end mut.each do |position,mutation| wt = mutation[0] mut_list = mutation[1] count_mut_list = mut_list.count_freq count_mut_list.each do |m,number| ci = ViralSeq::Math::BinomCI.new(number, n_seq) label = number < cutoff ? "*" : "" point_mutation_list << [region, n_seq, position, wt, m, number, ci.mean.round(5), ci.lower.round(5), ci.upper.round(5), label] end end point_mutation_list.sort_by! {|record| record[2]} link = mut_com.count_freq link2 = {} link.each do |k,v| pattern = [] if k.size == 0 pattern = ['WT'] else k.each do |p,m| pattern << (m[0] + p.to_s + m[1]) end end link2[pattern.join("+")] = v end linkage_list = [] link2.sort_by{|_key,value|value}.reverse.to_h.each do |k,v| ci = ViralSeq::Math::BinomCI.new(v, n_seq) label = v < cutoff ? "*" : "" linkage_list << [region, n_seq, k, v, ci.mean.round(5), ci.lower.round(5), ci.upper.round(5), label] end report_list = [] div_aa = {} aa_start = start_codon_number aa_size = aa.values[0].size - 1 (0..aa_size).to_a.each do |p| aas = [] aa.values.each do |r1| aas << r1[p] end count_aas = aas.count_freq div_aa[aa_start] = count_aas.sort_by{|_k,v|v}.reverse.to_h aa_start += 1 end div_aa.each do |k,v| record = [region, k, n_seq] ViralSeq::AMINO_ACID_LIST.each do |amino_acid| aa_count = v[amino_acid] record << (aa_count.to_f/n_seq*100).round(4) end report_list << record end return [point_mutation_list, linkage_list, report_list] end |
#sdrm_hiv_pr(cutoff = 0) ⇒ Array
functions to identify SDRMs from a ViralSeq::SeqHash object at HIV PR region.
works for MPID-DR protocol (dx.doi.org/10.17504/protocols.io.useewbe)
PR codon 1-99
RT codon 34-122 (HXB2 2650-2914) and 152-236(3001-3257)
IN codon 53-174 (HXB2 4384-4751)
139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 |
# File 'lib/viral_seq/hivdr.rb', line 139 def sdrm_hiv_pr(cutoff = 0) sequences = self.dna_hash region = "PR" rf_label = 0 start_codon_number = 1 n_seq = sequences.size mut = {} mut_com = [] aa = {} point_mutation_list = [] sequences.each do |name,seq| s = ViralSeq::Sequence.new(name,seq) s.translate(rf_label) aa[name] = s.aa_string record = s.sdrm(:hiv_pr) mut_com << record record.each do |position,mutation| if mut[position] mut[position][1] << mutation[1] else mut[position] = [mutation[0],[]] mut[position][1] << mutation[1] end end end mut.each do |position,mutation| wt = mutation[0] mut_list = mutation[1] count_mut_list = mut_list.count_freq count_mut_list.each do |m,number| ci = ViralSeq::Math::BinomCI.new(number, n_seq) label = number < cutoff ? "*" : "" point_mutation_list << [region, n_seq, position, wt, m, number, ci.mean.round(5), ci.lower.round(5), ci.upper.round(5), label] end end point_mutation_list.sort_by! {|record| record[2]} link = mut_com.count_freq link2 = {} link.each do |k,v| pattern = [] if k.size == 0 pattern = ['WT'] else k.each do |p,m| pattern << (m[0] + p.to_s + m[1]) end end link2[pattern.join("+")] = v end linkage_list = [] link2.sort_by{|_key,value|value}.reverse.to_h.each do |k,v| ci = ViralSeq::Math::BinomCI.new(v, n_seq) label = v < cutoff ? "*" : "" linkage_list << [region, n_seq, k, v, ci.mean.round(5), ci.lower.round(5), ci.upper.round(5), label] end report_list = [] div_aa = {} aa_start = start_codon_number aa_size = aa.values[0].size - 1 (0..aa_size).to_a.each do |p| aas = [] aa.values.each do |r1| aas << r1[p] end count_aas = aas.count_freq div_aa[aa_start] = count_aas.sort_by{|_k,v|v}.reverse.to_h aa_start += 1 end div_aa.each do |k,v| record = [region, k, n_seq] ViralSeq::AMINO_ACID_LIST.each do |amino_acid| aa_count = v[amino_acid] record << (aa_count.to_f/n_seq*100).round(4) end report_list << record end return [point_mutation_list, linkage_list, report_list] end |
#sdrm_hiv_rt(cutoff = 0) ⇒ Array
functions to identify SDRMs from a ViralSeq::SeqHash object at HIV RT region.
works for MPID-DR protocol (dx.doi.org/10.17504/protocols.io.useewbe)
RT codon 34-122, 152-236, two regions are linked
232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 |
# File 'lib/viral_seq/hivdr.rb', line 232 def sdrm_hiv_rt(cutoff = 0) sequences = self.dna_hash region = "RT" rf_label = 1 start_codon_number = 34 gap = "AGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCAC" n_seq = sequences.size mut_nrti = {} mut_nnrti = {} mut_com = [] r1_aa = {} r2_aa = {} point_mutation_list = [] sequences.each do |name,seq| r1 = seq[0,267] r2 = seq[267..-1] seq = r1 + gap + r2 s = ViralSeq::Sequence.new(name,seq) s.translate(rf_label) r1_aa[name] = s.aa_string[0,89] r2_aa[name] = s.aa_string[-85..-1] nrti = s.sdrm(:nrti, start_codon_number) nnrti = s.sdrm(:nnrti, start_codon_number) mut_com << (nrti.merge(nnrti)) nrti.each do |position,mutation| if mut_nrti[position] mut_nrti[position][1] << mutation[1] else mut_nrti[position] = [mutation[0],[]] mut_nrti[position][1] << mutation[1] end end nnrti.each do |position,mutation| if mut_nnrti[position] mut_nnrti[position][1] << mutation[1] else mut_nnrti[position] = [mutation[0],[]] mut_nnrti[position][1] << mutation[1] end end end mut_nrti.each do |position,mutation| wt = mutation[0] mut_list = mutation[1] count_mut_list = mut_list.count_freq count_mut_list.each do |m,number| ci = ViralSeq::Math::BinomCI.new(number, n_seq) label = number < cutoff ? "*" : "" point_mutation_list << ["NRTI", n_seq, position, wt, m, number, ci.mean.round(5), ci.lower.round(5), ci.upper.round(5), label] end end mut_nnrti.each do |position,mutation| wt = mutation[0] mut_list = mutation[1] count_mut_list = mut_list.count_freq count_mut_list.each do |m,number| ci = ViralSeq::Math::BinomCI.new(number, n_seq) label = number < cutoff ? "*" : "" point_mutation_list << ["NNRTI", n_seq, position, wt, m, number, ci.mean.round(5), ci.lower.round(5), ci.upper.round(5), label] end end point_mutation_list.sort_by! {|record| record[2]} link = mut_com.count_freq link2 = {} link.each do |k,v| pattern = [] if k.size == 0 pattern = ['WT'] else k.each do |p,m| pattern << (m[0] + p.to_s + m[1]) end end link2[pattern.join("+")] = v end linkage_list = [] link2.sort_by{|_key,value|value}.reverse.to_h.each do |k,v| ci = ViralSeq::Math::BinomCI.new(v, n_seq) label = v < cutoff ? "*" : "" linkage_list << [region, n_seq, k, v, ci.mean.round(5), ci.lower.round(5), ci.upper.round(5), label] end report_list = [] div_aa = {} r1_aa_start = 34 r2_aa_start = 152 r1_aa_size = r1_aa.values[0].size - 1 r2_aa_size = r2_aa.values[0].size - 1 (0..r1_aa_size).to_a.each do |p| aas = [] r1_aa.values.each do |r1| aas << r1[p] end count_aas = aas.count_freq div_aa[r1_aa_start] = count_aas.sort_by{|_k,v|v}.reverse.to_h r1_aa_start += 1 end (0..r2_aa_size).to_a.each do |p| aas = [] r2_aa.values.each do |r1| aas << r1[p] end count_aas = aas.count_freq div_aa[r2_aa_start] = count_aas.sort_by{|_k,v|v}.reverse.to_h r2_aa_start += 1 end div_aa.each do |k,v| record = [region, k, n_seq] ViralSeq::AMINO_ACID_LIST.each do |amino_acid| aa_count = v[amino_acid] record << (aa_count.to_f/n_seq*100).round(4) end report_list << record end return [point_mutation_list, linkage_list, report_list] end |
#sequence_locator(ref_option = :HXB2) ⇒ Array Also known as: loc
sequence locator for SeqHash object, resembling HIV Sequence Locator from LANL
808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 |
# File 'lib/viral_seq/seq_hash.rb', line 808 def sequence_locator(ref_option = :HXB2) out_array = [] dna_seq = self.dna_hash title = self.title uniq_dna = dna_seq.uniq_hash uniq_dna.each do |seq,names| s = ViralSeq::Sequence.new('',seq) loc1 = s.locator(ref_option) s.rc! loc2 = s.locator(ref_option) loc1[2] >= loc2[2] ? (direction = :+; loc = loc1): (direction = :-; loc = loc2) names.each do |name| out_array << ([title, name, ref_option.to_s, direction.to_s] + loc) end end return out_array end |
#shannons_entropy(option = :nt) ⇒ Hash
calculate Shannon’s entropy, Euler’s number as the base of logarithm
640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 |
# File 'lib/viral_seq/seq_hash.rb', line 640 def shannons_entropy(option = :nt) sequences = if option == :aa self.aa_hash.values else self.dna_hash.values end entropy_hash = {} seq_l = sequences[0].size (0..(seq_l - 1)).each do |position| element = [] sequences.each do |seq| element << seq[position] end entropy = 0 element.delete('*') element_size = element.size element.count_freq.each do |_k,v| p = v/element_size.to_f entropy += (-p * ::Math.log(p)) end entropy_hash[(position + 1)] = entropy end return entropy_hash end |
#size ⇒ Integer
the size of nt sequence hash of the SeqHash object
172 173 174 |
# File 'lib/viral_seq/seq_hash.rb', line 172 def size self.dna_hash.size end |
#stop_codon(codon_position = 0) ⇒ Hash
screen for sequences with stop codons.
354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 |
# File 'lib/viral_seq/seq_hash.rb', line 354 def stop_codon(codon_position = 0) self.translate(codon_position) keys = [] aa_seqs = self.aa_hash aa_seqs.uniq_hash.each do |seq,array_of_name| keys += array_of_name if seq.include?('*') end seqhash1 = self.sub(keys) seqhash1.title = self.title + "_stop" keys2 = aa_seqs.keys - keys seqhash2 = self.sub(keys2) return { with_stop_codon: seqhash1, without_stop_codon: seqhash2 } end |
#sub(keys) ⇒ SeqHash
given an Array of sequence tags, return a sub ViralSeq::SeqHash object with the sequence tags
314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 |
# File 'lib/viral_seq/seq_hash.rb', line 314 def sub(keys) h1 = {} h2 = {} h3 = {} keys.each do |k| dna = self.dna_hash[k] next unless dna h1[k] = dna aa = self.aa_hash[k] h2[k] = aa qc = self.qc_hash[k] h3[k] = qc end title = self.title file = self.file ViralSeq::SeqHash.new(h1,h2,h3,title,file) end |
#tn93 ⇒ Hash
TN93 distance functionl, tabulate pairwise comparison of sequence pairs in a sequence alignment, nt sequence only
715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 |
# File 'lib/viral_seq/seq_hash.rb', line 715 def tn93 sequences = self.dna_hash.values diff = [] seq_hash = sequences.count_freq seq_hash.values.each do |v| comb = v * (v - 1) / 2 comb.times {diff << 0} end seq_hash.keys.combination(2).to_a.each do |pair| s1 = pair[0] s2 = pair[1] diff_temp = s1.compare_with(s2) comb = seq_hash[s1] * seq_hash[s2] comb.times {diff << diff_temp} end count_diff = diff.count_freq out_hash = Hash.new(0) Hash[count_diff.sort_by{|k,_v|k}].each do |k,v| out_hash[k] = v end return out_hash end |
#to_rsphylip ⇒ String
generate sequences in relaxed sequencial phylip format from a ViralSeq::SeqHash object
239 240 241 242 243 244 245 246 247 248 249 250 |
# File 'lib/viral_seq/seq_hash.rb', line 239 def to_rsphylip seqs = self.dna_hash outline = "\s" + seqs.size.to_s + "\s" + seqs.values[0].size.to_s + "\n" names = seqs.keys names.collect!{|n| n.tr(">", "")} max_name_l = names.max.size max_name_l > 10 ? name_block_l = max_name_l : name_block_l = 10 seqs.each do |k,v| outline += k + "\s" * (name_block_l - k.size + 2) + v.scan(/.{1,10}/).join("\s") + "\n" end return outline end |
#translate(codon_position = 0) ⇒ NilClass
translate the DNA sequences in @dna_hash to amino acid sequences. generate value for @aa_hash
268 269 270 271 272 273 274 275 276 277 278 279 |
# File 'lib/viral_seq/seq_hash.rb', line 268 def translate(codon_position = 0) seqs = self.dna_hash @aa_hash = {} seqs.uniq_hash.each do |seq, array_of_name| s = ViralSeq::Sequence.new('name', seq) s.translate(codon_position) array_of_name.each do |name| @aa_hash[name] = s.aa_string end end return nil end |
#trim(start_nt, end_nt, ref_option = :HXB2, path_to_muscle = false) ⇒ ViralSeq::SeqHash
trim dna sequences based on the provided reference coordinates.
1189 1190 1191 1192 1193 1194 1195 1196 1197 1198 1199 1200 1201 1202 |
# File 'lib/viral_seq/seq_hash.rb', line 1189 def trim(start_nt, end_nt, ref_option = :HXB2, path_to_muscle = false) seq_hash = self.dna_hash.dup seq_hash_unique = seq_hash.uniq_hash trimmed_seq_hash = {} seq_hash_unique.each do |seq, names| trimmed_seq = ViralSeq::Sequence.new('', seq).sequence_clip(start_nt, end_nt, ref_option, path_to_muscle).dna names.each do |name| trimmed_seq_hash[name] = trimmed_seq end end return_seq_hash = self.dup return_seq_hash.dna_hash = trimmed_seq_hash return return_seq_hash end |
#uniq_dna_hash(tag = "sequence") ⇒ ViralSeq::SeqHash Also known as: uniq
collapse @dna_hash to unique sequence hash. sequences will be named as (tag + “_” + order(Integer) + “_” + counts(Integer))
292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 |
# File 'lib/viral_seq/seq_hash.rb', line 292 def uniq_dna_hash(tag = "sequence") seqs = self.dna_hash uni = seqs.values.count_freq new_seq = {} n = 1 uni.each do |s,c| name = ">" + tag + "_" + n.to_s + "_" + c.to_s new_seq[name] = s n += 1 end seq_hash = ViralSeq::SeqHash.new(new_seq) seq_hash.title = self.title + "_uniq" seq_hash.file = self.file return seq_hash end |
#write_nt_fa(file) ⇒ NilClass
write the nt sequences to a FASTA format file
213 214 215 216 217 218 219 220 |
# File 'lib/viral_seq/seq_hash.rb', line 213 def write_nt_fa(file) File.open(file, 'w') do |f| self.dna_hash.each do |k,v| f.puts k f.puts v end end end |