Class: Bio::SOFT
Overview
bio/db/soft.rb - Interface for SOFT formatted files
- Author
-
Trevor Wennblom <[email protected]>
- Copyright
-
Copyright © 2007 Midwinter Laboratories, LLC (midwinterlabs.com)
- License
-
The Ruby License
Description
“SOFT (Simple Omnibus in Text Format) is a compact, simple, line-based, ASCII text format that incorporates experimental data and metadata.” – GEO, National Center for Biotechnology Information
The Bio::SOFT module reads SOFT Series or Platform formatted files that contain information describing one database, one series, one platform, and many samples (GEO accessions). The data from the file can then be viewed with Ruby methods.
Bio::SOFT also supports the reading of SOFT DataSet files which contain one database, one dataset, and many subsets.
Format specification is located here:
SOFT data files may be directly downloaded here:
NCBI’s Gene Expression Omnibus (GEO) is here:
Usage
If an attribute has more than one value then the values are stored in an Array of String objects. Otherwise the attribute is stored as a String.
The platform and each sample may contain a table of data. A dataset from a DataSet file may also contain a table.
Attributes are dynamically created based on the data in the file. Predefined keys have not been created in advance due to the variability of SOFT files in-the-wild.
Keys are generally stored as Symbols. In the case of keys for samples and table headings may alternatively be accessed with Strings. The names of samples (geo accessions) are case sensitive. Table headers are case insensitive.
require 'bio'
lines = IO.readlines('GSE3457_family.soft')
soft = Bio::SOFT.new(lines)
soft.platform[:geo_accession] # => "GPL2092"
soft.platform[:organism] # => "Populus"
soft.platform[:contributor] # => ["Jingyi,,Li", "Olga,,Shevchenko", "Steve,H,Strauss", "Amy,M,Brunner"]
soft.platform[:data_row_count] # => "240"
soft.platform.keys.sort {|a,b| a.to_s <=> b.to_s}[0..2] # => [:contact_address, :contact_city, :contact_country]
soft.platform[:"contact_zip/postal_code"] # => "97331"
soft.platform[:table].header # => ["ID", "GB_ACC", "SPOT_ID", "Function/Family", "ORGANISM", "SEQUENCE"]
soft.platform[:table].header_description # => {"ORGANISM"=>"sequence sources", "SEQUENCE"=>"oligo sequence used", "Function/Family"=>"gene functions and family", "ID"=>"", "SPOT_ID"=>"", "GB_ACC"=>"Gene bank accession number"}
soft.platform[:table].rows.size # => 240
soft.platform[:table].rows[5] # => ["A039P68U", "AI163321", "", "TF, flowering protein CONSTANS", "P. tremula x P. tremuloides", "AGAAAATTCGATATACTGTCCGTAAAGAGGTAGCACTTAGAATGCAACGGAATAAAGGGCAGTTCACCTC"]
soft.platform[:table].rows[5][4] # => "P. tremula x P. tremuloides"
soft.platform[:table].rows[5][:organism] # => "P. tremula x P. tremuloides"
soft.platform[:table].rows[5]['ORGANISM'] # => "P. tremula x P. tremuloides"
soft.series[:geo_accession] # => "GSE3457"
soft.series[:contributor] # => ["Jingyi,,Li", "Olga,,Shevchenko", "Ove,,Nilsson", "Steve,H,Strauss", "Amy,M,Brunner"]
soft.series[:platform_id] # => "GPL2092"
soft.series[:sample_id].size # => 74
soft.series[:sample_id][0..4] # => ["GSM77557", "GSM77558", "GSM77559", "GSM77560", "GSM77561"]
soft.database[:name] # => "Gene Expression Omnibus (GEO)"
soft.database[:ref] # => "Nucleic Acids Res. 2005 Jan 1;33 Database Issue:D562-6"
soft.database[:institute] # => "NCBI NLM NIH"
soft.samples.size # => 74
soft.samples[:GSM77600][:series_id] # => "GSE3457"
soft.samples['GSM77600'][:series_id] # => "GSE3457"
soft.samples[:GSM77600][:platform_id] # => "GPL2092"
soft.samples[:GSM77600][:type] # => "RNA"
soft.samples[:GSM77600][:title] # => "jst2b2"
soft.samples[:GSM77600][:table].header # => ["ID_REF", "VALUE"]
soft.samples[:GSM77600][:table].header_description # => {"ID_REF"=>"", "VALUE"=>"normalized signal intensities"}
soft.samples[:GSM77600][:table].rows.size # => 217
soft.samples[:GSM77600][:table].rows[5] # => ["A039P68U", "8.19"]
soft.samples[:GSM77600][:table].rows[5][0] # => "A039P68U"
soft.samples[:GSM77600][:table].rows[5][:id_ref] # => "A039P68U"
soft.samples[:GSM77600][:table].rows[5]['ID_REF'] # => "A039P68U"
lines = IO.readlines('GDS100.soft')
soft = Bio::SOFT.new(lines)
soft.database[:name] # => "Gene Expression Omnibus (GEO)"
soft.database[:ref] # => "Nucleic Acids Res. 2005 Jan 1;33 Database Issue:D562-6"
soft.database[:institute] # => "NCBI NLM NIH"
soft.subsets.size # => 8
soft.subsets.keys # => ["GDS100_1", "GDS100_2", "GDS100_3", "GDS100_4", "GDS100_5", "GDS100_6", "GDS100_7", "GDS100_8"]
soft.subsets[:GDS100_7] # => {:dataset_id=>"GDS100", :type=>"time", :sample_id=>"GSM548,GSM543", :description=>"60 minute"}
soft.subsets['GDS100_7'][:sample_id] # => "GSM548,GSM543"
soft.subsets[:GDS100_7][:sample_id] # => "GSM548,GSM543"
soft.subsets[:GDS100_7][:dataset_id] # => "GDS100"
soft.dataset[:order] # => "none"
soft.dataset[:sample_organism] # => "Escherichia coli"
soft.dataset[:table].header # => ["ID_REF", "IDENTIFIER", "GSM549", "GSM542", "GSM543", "GSM547", "GSM544", "GSM545", "GSM546", "GSM548"]
soft.dataset[:table].rows.size # => 5764
soft.dataset[:table].rows[5] # => ["6", "EMPTY", "0.097", "0.217", "0.242", "0.067", "0.104", "0.162", "0.104", "0.154"]
soft.dataset[:table].rows[5][4] # => "0.242"
soft.dataset[:table].rows[5][:gsm549] # => "0.097"
soft.dataset[:table].rows[5][:GSM549] # => "0.097"
soft.dataset[:table].rows[5]['GSM549'] # => "0.097"
Defined Under Namespace
Classes: Database, Dataset, Entity, Platform, Sample, Samples, Series, Subset, Subsets, Table
Constant Summary collapse
- LINE_TYPE_ENTITY_INDICATOR =
'^'
- LINE_TYPE_ENTITY_ATTRIBUTE =
'!'
- LINE_TYPE_TABLE_HEADER =
'#'
- TABLE_COLUMN_DELIMITER =
data table row defined by absence of line type character
"\t"
Instance Attribute Summary collapse
-
#database ⇒ Object
Returns the value of attribute database.
-
#dataset ⇒ Object
Returns the value of attribute dataset.
-
#platform ⇒ Object
Returns the value of attribute platform.
-
#samples ⇒ Object
Returns the value of attribute samples.
-
#series ⇒ Object
Returns the value of attribute series.
-
#subsets ⇒ Object
Returns the value of attribute subsets.
Instance Method Summary collapse
-
#initialize(lines = nil) ⇒ SOFT
constructor
Constructor.
Constructor Details
#initialize(lines = nil) ⇒ SOFT
Constructor
Arguments
-
lines
: (required) contents of SOFT formatted file
- Returns
-
Bio::SOFT
147 148 149 150 151 152 153 154 155 156 157 158 |
# File 'lib/bio/db/soft.rb', line 147 def initialize(lines=nil) @database = Database.new @series = Series.new @platform = Platform.new @samples = Samples.new @dataset = Dataset.new @subsets = Subsets.new process(lines) end |
Instance Attribute Details
#database ⇒ Object
Returns the value of attribute database
130 131 132 |
# File 'lib/bio/db/soft.rb', line 130 def database @database end |
#dataset ⇒ Object
Returns the value of attribute dataset
132 133 134 |
# File 'lib/bio/db/soft.rb', line 132 def dataset @dataset end |
#platform ⇒ Object
Returns the value of attribute platform
131 132 133 |
# File 'lib/bio/db/soft.rb', line 131 def platform @platform end |
#samples ⇒ Object
Returns the value of attribute samples
131 132 133 |
# File 'lib/bio/db/soft.rb', line 131 def samples @samples end |
#series ⇒ Object
Returns the value of attribute series
131 132 133 |
# File 'lib/bio/db/soft.rb', line 131 def series @series end |
#subsets ⇒ Object
Returns the value of attribute subsets
132 133 134 |
# File 'lib/bio/db/soft.rb', line 132 def subsets @subsets end |