Class: BioDSL::TrimSeq

  • Object
show all
Defined in:


Trim sequence ends removing residues with a low quality score.

trim_seq removes subquality residues from the ends of sequences in the stream based on quality SCORES in a FASTQ type quality score string. Trimming progresses until a stretch, specified with the length_min option, is found thus preventing premature termination of the trimming by e.g. a single good quality residue at the end. It is possible, using the mode option to indicate if the sequence should be trimmed from the left or right end or both (default=:both).


trim_seq([quality_min: <uint>[, length_min: <uint>
         [, mode: <:left|:right|:both>]]])


  • quality_min: <uint> - Minimum quality (default=20).

  • length_min: <uint> - Minimum stretch length (default=3).

  • mode: <string> - Trim mode :left|:right|:both (default=:both).


Consider the following FASTQ entry in the file test.fq:


To trim both ends simply do: "test.fq")

SEQ_NAME: test
SEQ: tctgacgtatcgatcgttgattagttgctagctatgcagtctacgacgagcat

Use the quality_min option to change the minimum value to discard:
read_fastq(input: "test.fq").
trim_seq(quality_min: 25).

SEQ_NAME: test
SEQ: cgtatcgatcgttgattagttgctagctatgcagtctacgacgagcatgctagctag
SCORES: YZ[\]^_`abcdefghhgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDChhh

To trim the left end only (use :rigth for right end only), do: "test.fq").trim_seq(mode: :left)

SEQ_NAME: test
SEQ: tctgacgtatcgatcgttgattagttgctagctatgcagtctacgacgagcatgctagctag

To increase the length of stretch of good quality residues to match, use the length_min option: "test.fq").trim_seq(length_min: 4)

SEQ_NAME: test
SEQ: tctgacgtatcgatcgttgattagttgctagctatgcagtct
SCORES: TUVWXYZ[\]^_`abcdefghhgfedcba`_^]\[ZYXWVUT

Constant Summary collapse

%i(records_in records_out sequences_in sequences_out residues_in

Instance Method Summary collapse

Constructor Details

#initialize(options) ⇒ Proc, TrimSeq

Constructor for the TrimSeq class.


  • options (Hash)

    Options hash.

Options Hash (options):

  • :quality_min (Integer)

    TrimSeq minimum quality (default=20).

  • :mode (Symbol)

    TrimSeq mode (default=:both).

  • :length_min (Integer)

    TrimSeq stretch length triggering trim (default=3).

# File 'lib/BioDSL/commands/trim_seq.rb', line 123

def initialize(options)
  @options = options


  @mode = @options[:mode].to_sym
  @min  = @options[:quality_min]
  @len  = @options[:length_min]

Instance Method Details


Return a lambda for the trim_seq command.


  • (Proc)

    Returns the trim_seq command lambda.

# File 'lib/BioDSL/commands/trim_seq.rb', line 137

def lmb
  lambda do |input, output, status|
    status_init(status, STATS)

    input.each do |record|
      @status[:records_in] += 1

      trim_seq(record) if record[:SEQ] && record[:SCORES]

      output << record

      @status[:records_out] += 1