Class: BioDSL::ReadFasta
- Inherits:
-
Object
- Object
- BioDSL::ReadFasta
- Defined in:
- lib/BioDSL/commands/read_fasta.rb
Overview
Read FASTA entries from one or more files.
read_fasta read in sequence entries from FASTA files. Each sequence
entry consists of a sequence name prefixed by a '>' followed by the sequence
name on a line of its own, followed by one or my lines of sequence until the
next entry or the end of the file. The resulting Biopiece record consists of
the following record type:
{:SEQ_NAME=>"test",
:SEQ=>"AGCATCGACTAGCAGCATTT",
:SEQ_LEN=>20}
Input files may be compressed with gzip og bzip2.
For more about the FASTA format:
http://en.wikipedia.org/wiki/Fasta_format
Usage
read_fasta(input:
Options
- input
- Input file or file glob expression. - first
- Only read in the first number of entries. - last
- Only read in the last number of entries.
Examples
To read all FASTA entries from a file:
read_fasta(input: "test.fna")
To read all FASTA entries from a gzipped file:
read_fasta(input: "test.fna.gz")
To read in only 10 records from a FASTA file:
read_fasta(input: "test.fna", first: 10)
To read in the last 10 records from a FASTA file:
read_fasta(input: "test.fna", last: 10)
To read all FASTA entries from multiple files:
read_fasta(input: "test1.fna,test2.fna")
To read FASTA entries from multiple files using a glob expression:
read_fasta(input: "*.fna")
Constant Summary collapse
- STATS =
%i(records_in records_out sequences_in sequences_out residues_in residues_out)
Instance Method Summary collapse
-
#initialize(options) ⇒ ReadFasta
constructor
Constructor for the ReadFasta class.
-
#lmb ⇒ Proc
Return a lambda for the read_fasta command.
Constructor Details
#initialize(options) ⇒ ReadFasta
Constructor for the ReadFasta class.
93 94 95 96 97 98 99 |
# File 'lib/BioDSL/commands/read_fasta.rb', line 93 def initialize() @options = @count = 0 @buffer = [] end |
Instance Method Details
#lmb ⇒ Proc
Return a lambda for the read_fasta command.
104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 |
# File 'lib/BioDSL/commands/read_fasta.rb', line 104 def lmb lambda do |input, output, status| status_init(status, STATS) read_input(input, output) (@options[:input]).each do |file| BioDSL::Fasta.open(file) do |ios| if @options[:first] && read_first(ios, output) elsif @options[:last] && read_last(ios) else read_all(ios, output) end end end write_buffer(output) if @options[:last] end end |