Class: BioDSL::ReverseSeq

Inherits:
Object
  • Object
show all
Defined in:
lib/BioDSL/commands/reverse_seq.rb

Overview

Reverse sequences in the stream.

reverse_seq reverses sequences in the stream. If a SCORES key is found then the SCORES are also reversed.

reverse_seq can be used together with complment_seq to reverse- complement sequences.

Usage

reverse_seq()

Options

Examples

Consider the following FASTQ entry in the file test.fq:

@M02529:88:000000000-AC0WY:1:1101:12879:1928 2:N:0:185
TTGTAAAACGACGGCCAGTG
+
>>>>>FFFFD@A?A0AE0FG

To reverse the sequence simply do:

BD.new.read_fastq(input:"test.fq").reverse_seq.dump.run

{:SEQ_NAME=>"M02529:88:000000000-AC0WY:1:1101:12879:1928 2:N:0:185",
 :SEQ=>"GTGACCGGCAGCAAAATGTT",
 :SEQ_LEN=>20,
 :SCORES=>"GF0EA0A?A@DFFFF>>>>>"}

Constant Summary

STATS =
%i(records_in records_out sequences_in sequences_out residues_in
residues_out)

Instance Method Summary collapse

Constructor Details

#initialize(options) ⇒ ReverseSeq

Constructor for ReverseSeq.

Parameters:

  • options (Hash)

    Options hash.



69
70
71
72
73
# File 'lib/BioDSL/commands/reverse_seq.rb', line 69

def initialize(options)
  @options = options

  check_options
end

Instance Method Details

#lmbProc

Return command lambda for reverse_seq.

Returns:

  • (Proc)

    Command lambda.



78
79
80
81
82
83
84
85
86
87
88
89
# File 'lib/BioDSL/commands/reverse_seq.rb', line 78

def lmb
  lambda do |input, output, status|
    status_init(status, STATS)

    input.each do |record|
      @status[:records_in] += 1
      reverse(record) if record[:SEQ]
      output << record
      @status[:records_out] += 1
    end
  end
end