About
View is a plugin for the genomer tool for genome projects. This plugin can be used to generate the files required to upload a genome project. The files generated includes sequence and annotation files. Each of the possible file formats is documented with a manual page.
Usage
The following examples are taken from the Pseudomonas fluorescens R124 genome project. These examples can be run by downloading this project and running bundle install.
The following command can be used to generate a fasta file with associated metadata:
genomer view fasta \
--identifier='PRJNA68653' \
--organism='Pseudomonas fluorescens' \
--strain='R124' \
--gcode='11' \
--topology='circular' \
--isolation-source='Orthoquartzite Cave Surface' \
--collection-date='17-Oct-2007' \
--completeness='Complete' \
>PRJNA68653 [organism=Pseudomonas fluorescens] [strain=R124] [gcode=11] ...
TGTTACCTGGTTCGTCCACAACGGGCCGGAATGGCCCCCGTTTTAAGAGACCGGGGATTCTAGAGAAAGC
AAGCCTTCAGGTCAATTTCCAACCAACGTTTCCTTATAAATAGATATCTGGAGCATCCAGAACCAAGACC
TTGCCTGCCAAACATAAAAATAAAGAAGGGAATTATTTAAAGCTTTTCTGTAAAGCTTATAAAAGCTAGG
GCGACAGTCTCTGTGGATAACCATGTTCAGCCCTTGTCTGGCTTGATGTACAGAGAATGACAACTACAGT
GGAAAACCGTGGTCAGCCTGTGCTGCGCTGTCGGATAACCTGTGTGTGGAACCGTCAGTTATCCACAGGC
AGGTTATCCACCGAGTTCCACCCCCAGTTGTCCAGTGCCCTCAGAGGCGGTTATCCACAGAGCTTATTCA
CACACCGTTGGTCGCCTTTTTACCGGTTAACGCATTGATTAATCATGGTCACCACACAACCTGCATGTGG
...
The following can be used to generate an annotation table suitable for submission to GenBank using tbl2asn.
genomer view table \
--identifier=PRJNA68653 \
--reset_locus_numbering=52 \
--prefix='I1A_' \
--generate_encoded_features='gnl|BartonUAkron|' \
>Feature PRJNA68653 annotation_table
562 2076 gene
locus_tag I1A_000052
gene dnaA
562 2076 CDS
protein_id gnl|BartonUAkron|I1A_000052
product DnaA
function chromosomal replication initiator protein
2116 3219 gene
locus_tag I1A_000053
2116 3219 CDS
protein_id gnl|BartonUAkron|I1A_000053
product DNA polymerase III, beta subunit
...
Installation
Add this line to your genomer projects's Gemfile:
gem 'genomer-plugin-view'
And then execute in the project directory:
$ bundle
Run the help
command and the summary plugin should be available:
$ genomer help
$ genomer man view
Copyright
Genomer copyright (c) 2010 by Michael Barton. Genomer is licensed under the MIT license. See LICENSE.txt for further details. The Star of Bethlehem image is used under a Creative Commons Generic 2.0 Licence. The original can be found on flickr.