Module: Bioroebe::NucleotideModule
- Included in:
- DNA
- Defined in:
- lib/bioroebe/sequence/nucleotide_module/nucleotide_module.rb
Overview
Bioroebe::NucleotideModule
Class Method Summary collapse
-
.complementary_strand(i = @sequence.chars) ⇒ Object
# === Bioroebe::NucleotideModule.complementary_strand.
Instance Method Summary collapse
-
#allow_only_valid_dna(i = @sequence.dup) ⇒ Object
(also: #only_valid_dna_nucleotides)
# === allow_only_valid_dna.
-
#at_percentage ⇒ Object
(also: #at_percent, #AT_percentage)
# === at_percentage.
-
#back_from_rna(i = seq?) ) ⇒ Object
(also: #back_transcribe)
# === back_from_rna ========================================================================= #.
-
#codon_to_aminoacid(codon = sequence?) ) ⇒ Object
(also: #translate_aminoacid_into_dna)
# === codon_to_aminoacid.
-
#complementary_strand(i = '') ⇒ Object
(also: #complementary, #build_complementary_dna_strand, #build_second_strand, #build_complementary_strand)
# === complementary_strand ========================================================================= #.
-
#cut_with_enzyme(this_enzyme) ⇒ Object
# === cut_with_enzyme.
-
#gc_percentage ⇒ Object
(also: #gc_percent)
# === gc_percentage.
-
#has_stop_codon?(optional_use_this_frame = nil) ⇒ Boolean
# === has_stop_codon?.
-
#n_random_dna(n_elements = :default, do_also_assign = false) ⇒ Object
# === n_random_dna.
-
#random(n_elements = :default) ⇒ Object
# === random.
-
#remove_invalid_entries_from_the_dna_sequence ⇒ Object
# === remove_invalid_entries_from_the_dna_sequence.
-
#to_aminoacid_sequence(i = sequence?, , use_this_reading_frame = :default) ⇒ Object
(also: #translate)
# === to_aminoacid_sequence.
-
#to_dna(i = sequence?, , upcase_me = true) ⇒ Object
(also: #dna)
# === to_dna.
-
#to_rna(i = seq?) ) ⇒ Object
(also: #rna, #rna?, #transcribe, #to_RNA)
# === to_rna.
-
#to_T(i = seq?) ) ⇒ Object
# === to_T ========================================================================= #.
Class Method Details
.complementary_strand(i = @sequence.chars) ⇒ Object
#
Bioroebe::NucleotideModule.complementary_strand
This method will return the complementary strand. So, the complementary strand to “A” will be “T”; and from “T” it will be “A”; from “G” it will be “C” and from “C” it will be “G”.
Note that special “nucleotides” such as R or Y, may be used as well - R refers to a Purine, and Y refers to a Pyrimidine.
Usage example:
x = Bioroebe::Sequence.new('ATGCAA'); x.complementary # => "TACGTT"
#
30 31 32 33 34 35 36 37 38 39 |
# File 'lib/bioroebe/sequence/nucleotide_module/nucleotide_module.rb', line 30 def self.complementary_strand( i = @sequence.chars ) if i and i.is_a?(String) i = i.chars end return i.map {|line| ::Bioroebe.complementary_nucleotide(line) }.join end |
Instance Method Details
#allow_only_valid_dna(i = @sequence.dup) ⇒ Object Also known as: only_valid_dna_nucleotides
#
allow_only_valid_dna
Allow only valid DNA. It will discard anything that is not A, T, C or G.
“ATCGIIII”.allow_only_valid_dna
#
225 226 227 228 229 230 231 232 233 234 235 236 |
# File 'lib/bioroebe/sequence/nucleotide_module/nucleotide_module.rb', line 225 def allow_only_valid_dna( i = @sequence.dup ) return_string = ''.dup i.each_char { |entry| case entry.downcase when 'a','t','c','g' # Uracil is only in RNA, not in DNA. return_string << entry # But don't put the downcased string into that. end } return return_string end |
#at_percentage ⇒ Object Also known as: at_percent, AT_percentage
#
at_percentage
This is the complement of GC percentage, thus why we deduct from 100.
#
163 164 165 |
# File 'lib/bioroebe/sequence/nucleotide_module/nucleotide_module.rb', line 163 def at_percentage (100 - gc_percentage) end |
#back_from_rna(i = seq?) ) ⇒ Object Also known as: back_transcribe
#
back_from_rna
#
125 126 127 |
# File 'lib/bioroebe/sequence/nucleotide_module/nucleotide_module.rb', line 125 def back_from_rna(i = seq?) i.tr('U','T') end |
#codon_to_aminoacid(codon = sequence?) ) ⇒ Object Also known as: translate_aminoacid_into_dna
#
codon_to_aminoacid
This method will translate a DNA-codon (or RNA-codon) into the corresponding aminoacid.
Usage example:
codon_to_aminoacid TCC
#
250 251 252 |
# File 'lib/bioroebe/sequence/nucleotide_module/nucleotide_module.rb', line 250 def codon_to_aminoacid(codon = sequence?) ::Bioroebe.codon_to_aminoacid(codon) end |
#complementary_strand(i = '') ⇒ Object Also known as: complementary, build_complementary_dna_strand, build_second_strand, build_complementary_strand
#
complementary_strand
#
48 49 50 |
# File 'lib/bioroebe/sequence/nucleotide_module/nucleotide_module.rb', line 48 def complementary_strand(i = '') return ::Bioroebe.complementary_strand(i) end |
#cut_with_enzyme(this_enzyme) ⇒ Object
#
cut_with_enzyme
Use this method to cut the given sequence via a restriction enzyme. This is only relevant for DNA or RNA, not proteins - at the least in regards to restriction enzymes. Obviously proteins may be cleavable via proteolytic enzymes.
Usage example:
sequence = Bioroebe::Sequence.new(::Bioroebe.return_random_aminoacid(50)); result = sequence.cut_with_enzyme 'EcoRI'
sequence = Bioroebe::Sequence.new(150); result = sequence.cut_with_enzyme 'EcoRI'
#
143 144 145 146 147 |
# File 'lib/bioroebe/sequence/nucleotide_module/nucleotide_module.rb', line 143 def cut_with_enzyme(this_enzyme) require 'bioroebe/enzymes/restriction_enzyme.rb' target_sequence = ::Bioroebe.restriction_enzyme("#{this_enzyme}.site") main_string?.split(/#{target_sequence}/) end |
#gc_percentage ⇒ Object Also known as: gc_percent
#
gc_percentage
This will return, as a float (aka number), the percentage of GC of a given RNA or DNA string. An example value may be 55.3, which stands for 55.3%.
It will not work if .type? is a protein, though, which is why it is part of this module, so that we can avoid calling it on a protein.
Usage example:
x = Bioroebe::Sequence.new('AGCT'); x.gc_percentage
#
111 112 113 114 115 116 117 118 119 120 |
# File 'lib/bioroebe/sequence/nucleotide_module/nucleotide_module.rb', line 111 def gc_percentage( round_to_n_positions = 2 ) sum = @sequence.count('G') + @sequence.count('C') result = (sum * 100.0 / @sequence.size) if round_to_n_positions result = result.round(round_to_n_positions) end return result end |
#has_stop_codon?(optional_use_this_frame = nil) ⇒ Boolean
#
has_stop_codon?
This method will return true if the sequence includes at the least one stop codon; otherwise this method will return false.
Usage examples:
require 'bioroebe'; include Bioroebe; x = Seq('ATC GTC GGA ATAG'); puts x.has_stop_codon? # false
require 'bioroebe'; include Bioroebe; x = Seq('ATG GTC GGA ATAG'); puts x.has_stop_codon? :frame1 # true
require 'bioroebe'; include Bioroebe; x = Seq('ATG GTC GGA ATAG'); puts x.has_stop_codon? :frame2
require 'bioroebe'; include Bioroebe; x = Seq('ATG GTC GGA ATAG'); puts x.has_stop_codon? :frame3
#
182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 |
# File 'lib/bioroebe/sequence/nucleotide_module/nucleotide_module.rb', line 182 def has_stop_codon?( optional_use_this_frame = nil ) _ = @sequence stop_codons = ::Bioroebe.stop_codons? # ======================================================================= # # We must ensure that the stop-codons are actually initialized. If not # then we will do so here quickly, then re-assign. # ======================================================================= # if stop_codons.empty? ::Bioroebe.initialize_stop_codons stop_codons = ::Bioroebe.stop_codons? end if optional_use_this_frame case optional_use_this_frame when :frame1, :in_frame1 _ = _.scan(/.../) when :frame2, :in_frame2 _ = _[1..-1].scan(/.../) when :frame3, :in_frame3 _ = _[2..-1].scan(/.../) else e 'Unknown input: '+orange(optional_use_this_frame.to_s)+ ' (class '+optional_use_this_frame.class.to_s+')' return false end stop_codons.any? {|this_stop_codon_triplett| _.include? this_stop_codon_triplett } else stop_codons.any? {|this_stop_codon_triplett| _.include? this_stop_codon_triplett } end end |
#n_random_dna(n_elements = :default, do_also_assign = false) ⇒ Object
#
n_random_dna
This method will assign a random DNA sequence.
The first argument tells us how long that sequence should be, defaulting to 100.
The second argument means that we will also invoke set_string(), which may lead to an infinite loop if you are not careful, so be mindful of that.
#
87 88 89 90 91 92 93 94 95 96 97 98 |
# File 'lib/bioroebe/sequence/nucleotide_module/nucleotide_module.rb', line 87 def n_random_dna( n_elements = :default, do_also_assign = false ) case n_elements when :default n_elements = 100 end _ = n_elements.to_i.times.map { DNA_NUCLEOTIDES.sample }.join.strip set_string(_) if do_also_assign return _ end |
#random(n_elements = :default) ⇒ Object
#
random
This method is only for DNA really.
#
259 260 261 262 263 |
# File 'lib/bioroebe/sequence/nucleotide_module/nucleotide_module.rb', line 259 def random(n_elements = :default) n_random_dna( n_elements, true ) if is_dna? end |
#remove_invalid_entries_from_the_dna_sequence ⇒ Object
#
remove_invalid_entries_from_the_dna_sequence
Get rid of all entries except for A, T, G and C.
#
154 155 156 |
# File 'lib/bioroebe/sequence/nucleotide_module/nucleotide_module.rb', line 154 def remove_invalid_entries_from_the_dna_sequence @sequence.tr!('B,D-F,H-S,U-Z','') if @sequence end |
#to_aminoacid_sequence(i = sequence?, , use_this_reading_frame = :default) ⇒ Object Also known as: translate
#
to_aminoacid_sequence
If you wish to convert the main sequence into the corresponding aminoacid sequence, use this method here.
You can specify a different reading frame as well - see the usage example that follows.
Usage example if you have a sequence object called seq:
seq = Bioroebe::Sequence.new(50); seq.translate(:frame_two)
seq = Bioroebe::Sequence.new(50); seq.translate(table: "Vertebrate Mitochondrial")
seq = Bioroebe::Sequence.new("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG"); seq.translate(table: "Vertebrate Mitochondrial")
#
281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 |
# File 'lib/bioroebe/sequence/nucleotide_module/nucleotide_module.rb', line 281 def to_aminoacid_sequence( i = sequence?, use_this_reading_frame = :default # This is :frame_one. ) if i.is_a? Hash if i.has_key? :table Bioroebe.set_use_this_codon_table(i.delete(:table)) use_this_reading_frame = :default i = sequence? end end # ======================================================================= # # We must sanitize the first argument if it is a Symbol, at the least # for 3 specific symbols. # ======================================================================= # if i.is_a? Symbol case i when :frame_one, :default i = sequence? use_this_reading_frame = :frame_one when :frame_two i = sequence? use_this_reading_frame = :frame_two when :frame_three i = sequence? use_this_reading_frame = :frame_three end end unless Bioroebe.const_defined? :DnaToAminoacidSequence require 'bioroebe/conversions/dna_to_aminoacid_sequence.rb' end _ = ::Bioroebe::DnaToAminoacidSequence.new( i, :do_not_run_yet ) # bl $BIOROEBE/conversions/dna_to_aminoacid_sequence.rb _.be_quiet_and_no_colours case i # ======================================================================= # # === :frame_one # ======================================================================= # when :frame_one, :from_frame_one, 'one','1',1 use_this_reading_frame = :frame_one i = sequence? _.use_this_sequence = i # ======================================================================= # # === :frame_two # ======================================================================= # when :frame_two, :from_frame_two,'two','2',2 use_this_reading_frame = :frame_two i = sequence? _.use_this_sequence = i when :frame_three, :from_frame_three,'three','3',3 use_this_reading_frame = :frame_three i = sequence? _.use_this_sequence = i end # ======================================================================= # # We may also use another reading frame, which will be handled next. # ======================================================================= # _.use_this_reading_frame = use_this_reading_frame _.run return _.sequence? end |
#to_dna(i = sequence?, , upcase_me = true) ⇒ Object Also known as: dna
387 388 389 390 391 392 393 394 |
# File 'lib/bioroebe/sequence/nucleotide_module/nucleotide_module.rb', line 387 def to_dna( i = sequence?, upcase_me = true ) i = sequence? if i.nil? i = ::Bioroebe.to_dna(i, upcase_me) return i end |
#to_rna(i = seq?) ) ⇒ Object Also known as: rna, rna?, transcribe, to_RNA
#
to_rna
This method will simply return the RNA sequence corresponding to the DNA sequence.
#
61 62 63 |
# File 'lib/bioroebe/sequence/nucleotide_module/nucleotide_module.rb', line 61 def to_rna(i = seq?) i.tr('T','U') end |
#to_T(i = seq?) ) ⇒ Object
#
to_T
#
71 72 73 |
# File 'lib/bioroebe/sequence/nucleotide_module/nucleotide_module.rb', line 71 def to_T(i = seq?) i.tr('U','T') end |