File: tiling — Documentation for bio-maf (1.0.1)

Feature: Join alignment blocks with reference data In order to produce FASTA output with one sequence per species For use in downstream tools We need to join adjacent MAF blocks together And fill gaps in the reference sequence from reference data

Scenario: Non-overlapping MAF blocks in region of interest Given MAF data: """ ##maf version=1 a score=20.0 s sp1.chr1 10 13 + 50 GGGCTGAGGGC--AG s sp2.chr5 53010 13 + 65536 GGGCTGACGGC--AG s sp3.chr2 33010 15 + 65536 AGGTTTAGGGCAGAG

a score=21.0
s sp1.chr1        30 10 +      50 AGGGCGGTCC
s sp2.chr5     53030 10 +   65536 AGGGCGGTGC
"""
And chromosome reference sequence:
"""
>sp1.chr1
CCAGGATGCT
GGGCTGAGGG
CAGTTGTGTC
AGGGCGGTCC
GGTGCAGGCA
"""
When I open it with a MAF reader
And build an index on the reference sequence
And tile sp1.chr1:0-50 with the chromosome reference
And tile with species [sp1, sp2, sp3]
And write the tiled data as FASTA
Then the FASTA data obtained should be:
"""
>sp1
CCAGGATGCTGGGCTGAGGGC--AGTTGTGTCAGGGCGGTCCGGTGCAGGCA
>sp2
**********GGGCTGACGGC--AG*******AGGGCGGTGC**********
>sp3
**********AGGTTTAGGGCAGAG***************************
"""

Scenario: Non-overlapping MAF blocks with species map Given MAF data: """ ##maf version=1 a score=20.0 s sp1.chr1 10 13 + 50 GGGCTGAGGGC--AG s sp2.chr5 53010 13 + 65536 GGGCTGACGGC--AG s sp3.chr2 33010 15 + 65536 AGGTTTAGGGCAGAG

a score=21.0
s sp1.chr1        30 10 +      50 AGGGCGGTCC
s sp2.chr5     53030 10 +   65536 AGGGCGGTGC
"""
And chromosome reference sequence:
"""
>sp1.chr1
CCAGGATGCT
GGGCTGAGGG
CAGTTGTGTC
AGGGCGGTCC
GGTGCAGGCA
"""
When I open it with a MAF reader
And build an index on the reference sequence
And tile sp1.chr1:0-50 with the chromosome reference
And tile with species [sp1, sp2, sp3]
And map species sp1 as mouse
And map species sp2 as hippo
And map species sp3 as squid
And write the tiled data as FASTA
Then the FASTA data obtained should be:
"""
>mouse
CCAGGATGCTGGGCTGAGGGC--AGTTGTGTCAGGGCGGTCCGGTGCAGGCA
>hippo
**********GGGCTGACGGC--AG*******AGGGCGGTGC**********
>squid
**********AGGTTTAGGGCAGAG***************************
"""

Scenario: Subset of non-overlapping MAF blocks in region Given MAF data: """ ##maf version=1 a score=20.0 s sp1.chr1 10 13 + 50 GGGCTGAGGGC--AG s sp2.chr5 53010 13 + 65536 GGGCTGACGGC--AG s sp3.chr2 33010 15 + 65536 AGGTTTAGGGCAGAG

a score=21.0
s sp1.chr1        30 10 +      50 AGGGCGGTCC
s sp2.chr5     53030 10 +   65536 AGGGCGGTGC
"""
And chromosome reference sequence:
"""
>sp1.chr1
CCAGGATGCT
GGGCTGAGGG
CAGTTGTGTC
AGGGCGGTCC
GGTGCAGGCA
"""
When I open it with a MAF reader
And build an index on the reference sequence
And tile sp1.chr1:12-36 with the chromosome reference
And tile with species [sp1, sp2, sp3]
And write the tiled data as FASTA
Then the FASTA data obtained should be:
"""
>sp1
GCTGAGGGC--AGTTGTGTCAGGGCG
>sp2
GCTGACGGC--AG*******AGGGCG
>sp3
GTTTAGGGCAGAG*************
"""

Scenario: Overlapping MAF blocks in region of interest Given MAF data: """ ##maf version=1 a score=20.0 s sp1.chr1 10 13 + 50 GGGCTGAGGGC--AG s sp2.chr5 53010 13 + 65536 GGGCTGACGGC--AG s sp3.chr2 33010 15 + 65536 AGGTTTAGGGCAGAG

a score=21.0
s sp1.chr1        20 10 +      50 AGGGCGGTCC
s sp2.chr5     53020 10 +   65536 AGGGCGGTGC
"""
And chromosome reference sequence:
"""
>sp1.chr1
CCAGGATGCT
GGGCTGAGGG
CAGTTGTGTC
AGGGCGGTCC
GGTGCAGGCA
"""
When I open it with a MAF reader
And build an index on the reference sequence
And tile sp1.chr1:0-50 with the chromosome reference
And tile with species [sp1, sp2, sp3]
And write the tiled data as FASTA
Then the FASTA data obtained should be:
"""
>sp1
CCAGGATGCTGGGCTGAGGGAGGGCGGTCCAGGGCGGTCCGGTGCAGGCA
>sp2
**********GGGCTGACGGAGGGCGGTGC********************
>sp3
**********AGGTTTAGGG******************************
"""

@no_jruby Scenario: Tile with CLI tool and reference seq Given test files: | gap-sp1.fa.gz | | gap-1.maf | | gap-1.kct | When I run maf_tile --reference gap-sp1.fa.gz --interval 0-50 -s sp1:mouse -s sp2:nautilus -s sp3:jaguar gap-1.maf gap-1.kct Then it should pass with: """ >mouse CCAGGATGCTGGGCTGAGGGC--AGTTGTGTCAGGGCGGTCCGGTGCAGGCA >nautilus *******GGGCTGACGGC--AG*AGGGCGGTGC******* >jaguar *******AGGTTTAGGGCAGAG************************ """

@no_jruby Scenario: Tile with CLI tool and no reference seq Given test files: | gap-1.maf | | gap-1.kct | When I run maf_tile --interval 0-50 -s sp1:mouse -s sp2:nautilus -s sp3:jaguar gap-1.maf gap-1.kct Then it should pass with: """ >mouse NNNNNNNNNNGGGCTGAGGGC--AGNNNNNNNAGGGCGGTCCNNNNNNNNNN >nautilus *******GGGCTGACGGC--AG*AGGGCGGTGC******* >jaguar *******AGGTTTAGGGCAGAG************************ """

@no_jruby Scenario: Tile with CLI tool and BED intervals Given test files: | gap-1.maf | | gap-1.kct | | gap-sp1.fa.gz | And a file named "example.bed" with: """ sp1.chr1 12 36 """ When I run maf_tile -s sp1:mouse -s sp2:nautilus -s sp3:jaguar --output-base selected --bed example.bed --reference gap-sp1.fa.gz gap-1.maf gap-1.kct Then it should pass with: """ """ And the file "selected_12-36.fa" should contain exactly: """ >mouse GCTGAGGGC--AGTTGTGTCAGGGCG >nautilus GCTGACGGC--AG****AGGGCG >jaguar GTTTAGGGCAGAG**********

"""

@no_jruby Scenario: Tile with CLI tool and implicit index Given test files: | mm8_chr7_tiny.maf | | mm8_chr7_tiny.kct | When I run maf_tile -s mm8 -s rn4 -s hg18 --interval 80082334-80082344 mm8_chr7_tiny.maf Then it should pass with: """ >mm8 GGGCTGAGGG >rn4 GGGCTGAGGG >hg18 --------GG """

@no_jruby Scenario: Tile with CLI tool and directory Given test files: | mm8_chr7_tiny.maf | | mm8_chr7_tiny.kct | When I run maf_tile -s mm8 -s rn4 -s hg18 --interval mm8.chr7:80082334-80082344 . Then it should pass with: """ >mm8 GGGCTGAGGG >rn4 GGGCTGAGGG >hg18 --------GG """

@no_jruby Scenario: Tile with CLI tool and directory, 1-based Given test files: | mm8_chr7_tiny.maf | | mm8_chr7_tiny.kct | When I run maf_tile -s mm8 -s rn4 -s hg18 --one-based --interval mm8.chr7:80082335-80082344 . Then it should pass with: """ >mm8 GGGCTGAGGG >rn4 GGGCTGAGGG >hg18 --------GG """